IGF2BP3 cloning plasmid
-
Catalog numberCSB-CL011092HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the IGF2BP3 gene.
-
SpecificationsGene name: IGF2BP3; Gene ID: 10643; Accession number: BC051296; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 303; Sequence: atgaacaaactgtatatcggaaacctcagcgagaacgccgccccctcggacctagaaagtatcttcaaggacgccaagatcccggtgtcgggacccttcctggtgaagactggctacgcgttcgtggactgcccggacgagagctgggccctcaaggccatcgaggcgctttcaggtaaaatagaactgcacgggaaacccatagaagttgagcactcggtcccaaaaaggcaaaggattcggaaacttcagatacgaaatatcccgcctcatttacagtgggaggaaatggggcagccttga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolIGF2BP3
-
Short nameIGF2BP3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameinsulin-like growth factor 2 messenger RNA binding protein 3 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetinsulin-like growth factor 2 mRNA binding protein 3, CT98 and IMP-3 and IMP3 and KOC and KOC1 and VICKZ3, IGF2BP3 and IDBG-9675 and ENSG00000136231 and 10643, mRNA 5'-UTR binding, nuclei, Igf2bp3 and IDBG-146190 and ENSMUSG00000029814 and 140488, IGF2BP3 and IDBG-630336 and ENSBTAG00000019406 and 539650
-
Gene info
-
Identity
-
Gene
-
Long gene nameinsulin like growth factor 2 mRNA binding protein 3
-
Synonyms gene name
- insulin-like growth factor 2 mRNA binding protein 3
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2006-02-09
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- RNA binding motif containing
-
VEGA ID