IFNW1 cloning plasmid
-
Catalog numberCSB-CL011061HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the IFNW1 gene.
-
SpecificationsGene name: IFNW1; Gene ID: 3467; Accession number: BC117290; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 588; Sequence: atggccctcctgttccctctactggcagccctagtgatgaccagctatagccctgttggatctctgggctgtgatctgcctcagaaccatggcctacttagcaggaacaccttggtgcttctgcaccaaatgaggagaatctcccctttcttgtgtctcaaggacagaagagacttcaggttcccccaggagatggtaaaagggagccagttgcagaaggcccatgtcatgtctgtcctccatgagatgctgcagcagatcttcagcctcttccacacagagcgctcctctgctgcctggaacatgaccctcctagaccaactccacactggacttcatcagcaactgcaacacctggagacctgcttgctgcaggtagtgggagaaggagaatctgctggggcaattagcagccctgcactgaccttgaggaggtacttccagggaatccgtgtctacctgaaagagaagaaatacagcgactgtgcctgggaagttgtcagaatggaaatcatgaaatccttgttcttatcaacaaacatgcaagaaagactgagaagtaaagatagagacctgggctcatcttga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolIFNW1
-
Short nameIFNW1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameinterferon, omega 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetinterferon, omega 1, IFNW1 and IDBG-53542 and ENSG00000177047 and 3467, type I interferon receptor binding, Extracellular
-
Gene info
-
Identity
-
Gene
-
Long gene nameinterferon omega 1
-
Synonyms name
-
Locus
-
Discovery year1992-11-06
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Interferons
-
VEGA ID
MeSH Data
-
Name
-
ConceptScope note: The assay of INTERFERON-GAMMA released from lymphocytes after their exposure to a specific test antigen, to check for IMMUNOLOGIC MEMORY resulting from a previous exposure to the antigen. The amount of interferon-gamma released is usually assayed by an ENZYME-LINKED IMMUNOSORBENT ASSAY.
-
Tree numbers
- E01.370.225.812.453
- E05.200.812.453
- E05.478.594.475
-
Qualifiersethics, trends, veterinary, history, classification, economics, instrumentation, methods, standards, statistics & numerical data