ID1 cloning plasmid

• Catalog number
  CSB-CL010966HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the ID1 gene.
• Specifications
  Gene name: ID1; Gene ID: 3397; Accession number: BC000613; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 468; Sequence: atgaaagtcgccagtggcagcaccgccaccgccgccgcgggccccagctgcgcgctgaaggccggcaagacagcgagcggtgcgggcgaggtggtgcgctgtctgtctgagcagagcgtggccatctcgcgctgcgccgggggcgccggggcgcgcctgcctgccctgctggacgagcagcaggtaaacgtgctgctctacgacatgaacggctgttactcacgcctcaaggagctggtgcccaccctgccccagaaccgcaaggtgagcaaggtggagattctccagcacgtcatcgactacatcagggaccttcagttggagctgaactcggaatccgaagttggaacccccgggggccgagggctgccggtccgggctccgctcagcaccctcaacggcgagatcagcgccctgacggccgaggcggcatgcgttcctgcggacgatcgcatcttgtgtcgctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  ID1   cloning  
• Gene symbol
  ID1
• Short name
  ID1 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  inhibitor on DNA binding 1, dominant negative helix-loop-helix protein cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  inhibitor of DNA binding 1, dominant negative helix-loop-helix protein, bHLHb24 and ID, ID1 and IDBG-63543 and ENSG00000125968 and 3397, protein dimerization activity, nuclei, Id1 and IDBG-209844 and ENSMUSG00000042745 and 15901, ID1 and IDBG-641533 and ENSBTAG00000016169 and 497011

Gene info

• Identity
  HGNC:5360
• Gene
  ID1
• Long gene name
  inhibitor of DNA binding 1, HLH protein
• Synonyms gene name
  • inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
• Synonyms
  • dJ857M17.1.2
  • bHLHb24
• Synonyms name
  • DNA-binding protein inhibitor ID-1
  • inhibitor of differentiation 1
• Locus
  20q11.21
• Discovery year
  1994-12-22
• Entrez gene record
  3397
• Pubmed identfication
  • 8294468
• RefSeq identity
  • NM_002165
• Classification
  • Basic helix-loop-helix proteins
• VEGA ID
  OTTHUMG00000032181

Similar products