HSP90B1 cloning plasmid

• Catalog number
  CSB-CL010814HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the HSP90B1 gene.
• Specifications
  Gene name: HSP90B1; Gene ID: 7184; Accession number: BC009195; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 948; Sequence: atgagggccctgtgggtgctgggcctctgctgcgtcctgctgaccttcgggtcggtcagagctgacgatgaagttgatgtggatggtacagtagaagaggatctgggtaaaagtagagaaggatcaaggacggatgatgaagtagtacagagagaggaagaagctattcagttggatggattaaatgcatcacaaataagagaacttagagagaagtcggaaaagtttgccttccaagccgaagttaacagaatgatgaaacttatcatcaattcattgtataaaaataaagagattttcctgagagaactgatttcaaatgcttctgatgctttagataagataaggctaatatcactgactgatgaaaatgctctttctggaaatgaggaactaacagtcaaaattaagtgtgataaggagaagaacctgctgcatgtcacagacaccggtgtaggaatgaccagagaagagttggttaaaaaccttggtaccatagccaaatctgggacaagcgagtttttaaacaaaatgactgaagcacaggaagatggccagtcaacttctgaattgattggccagtttggtgtcggtttctattccgccttccttgtagcagataaggttattgtcacttcaaaacacaacaacgatacccagcacatctgggagtctgactccaatgaattttctgtaattgctgacccaagaggaaacactctaggacggggaacgacaattacccttgtcttaaaagaagaagcatctgattaccttgaattggatacaattaaaaatctcgtcaaaaaatattcacagttcataaactttcctatttatgtatggagcagcaagactgaaactgttgaggagcccatggaggaagaagaagcagccaaagaagagaaagaagaatctgatgatgaagctgcagcaagacgaagatga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  HSP90B1   cloning  
• Gene symbol
  HSP90B1
• Short name
  HSP90B1 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  heat shock protein 90kDa b (Grp94), member 1 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  heat shock protein 90kDa beta (Grp94), member 1, ECGP and GP96 and GRP94 and HEL-S-125m and HEL35 and TRA1, HSP90B1 and IDBG-54092 and ENSG00000166598 and 100500842,7184, unfolded protein binding, nuclei, Hsp90b1 and IDBG-182078 and ENSMUSG00000020048 and 22027, HSP90B1 and IDBG-637404 and ENSBTAG00000003362 and 282646

Gene info

• Identity
  HGNC:12028
• Gene
  HSP90B1
• Long gene name
  heat shock protein 90 beta family member 1
• Synonyms gene
  • TRA1
• Synonyms gene name
  • tumor rejection antigen (gp96) 1
  • heat shock protein 90kDa beta (Grp94), member 1
• Synonyms
  • GP96
  • GRP94
• Synonyms name
  • endoplasmin
• GenBank acession
  • AY040226
• Locus
  12q23.3
• Discovery year
  1991-07-03
• Entrez gene record
  7184
• Pubmed identfication
  • 16269234
• RefSeq identity
  • NM_003299
• Classification
  • Heat shock 90kDa proteins
  • MicroRNA protein coding host genes
• VEGA ID
  OTTHUMG00000170118

Similar products