HEPACAM cloning plasmid

• Catalog number
  CSB-CL010287HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the HEPACAM gene.
• Specifications
  Gene name: HEPACAM; Gene ID: 220296; Accession number: BC113562; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1251; Sequence: atgaagagagaaaggggagccctgtccagagcctccagggccctgcgccttgctccttttgtctaccttcttctgatccagacagaccccctggagggggtgaacatcaccagccccgtgcgcctgatccatggcaccgtggggaagtcggctctgctttctgtgcagtacagcagtaccagcagcgacaggcctgtagtgaagtggcagctgaagcgggacaagccagtgaccgtggtgcagtccattggcacagaggtcatcggcaccctgcggcctgactatcgagaccgtatccgactctttgaaaatggctccctgcttctcagcgacctgcagctggccgatgagggcacctatgaggtcgagatctccatcaccgacgacaccttcactggggagaagaccatcaaccttactgtagatgtgcccatttcgaggccacaggtgttggtggcttcaaccactgtgctggagctcagcgaggccttcaccttgaactgctcacatgagaatggcaccaagcccagctacacctggctgaaggatggcaagcccctcctcaatgactcgagaatgctcctgtcccccgaccaaaaggtgctcaccatcacccgcgtgctcatggaggatgacgacctgtacagctgcatggtggagaaccccatcagccagggccgcagcctgcctgtcaagatcaccgtatacagaagaagctccctttacatcatcttgtctacaggaggcatcttcctccttgtgaccttggtgacagtctgtgcctgctggaaaccctccaaaaggaaacagaagaagctagaaaagcaaaactccctggaatacatggatcagaatgatgaccgcctgaaaccagaagcagacaccctccctcgaagtggtgagcaggaacggaagaaccccatggcactctatatcctgaaggacaaggactccccggagaccgaggagaacccggccccggagcctcgaagcgcgacggagcccggcccgcccggctactccgtgtctcccgccgtgcccggccgctcgccggggctgcccatccgctctgcccgccgctacccgcgctccccagcgcgctccccagccaccggccggacacactcgtcgccgcccagggccccgagctcgcccggccgctcgcgcagcgcctcgcgcacactgcggactgcgggcgtgcacataatccgcgagcaagacgaggccggcccggtggagatcagcgcctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  HEPACAM   cloning  
• Gene symbol
  HEPACAM
• Short name
  HEPACAM cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  hepatic and glial cellular adhesion molecule cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  hepatic and glial cell adhesion molecule, HEPACAM and IDBG-75353 and ENSG00000165478 and 220296,641654, protein binding, Cell surfaces, Hepacam and IDBG-150034 and ENSMUSG00000046240 and 72927, HEPACAM and IDBG-642655 and ENSBTAG00000018650 and 521015

Gene info

• Identity
  HGNC:26361
• Gene
  HEPACAM
• Long gene name
  hepatic and glial cell adhesion molecule
• Synonyms gene name
  • hepatocyte cell adhesion molecule
• Synonyms
  • FLJ25530
  • GLIALCAM
• Synonyms name
  • glial cell adhesion molecule
• GenBank acession
  • AK098396
• Locus
  11q24.2
• Discovery year
  2007-01-22
• Entrez gene record
  220296
• Pubmed identfication
  • 15885354
  • 15917256
• RefSeq identity
  • NM_152722
• Classification
  • Ig-like cell adhesion molecule family
  • V-set domain containing
• VEGA ID
  OTTHUMG00000165938

Similar products