HAPLN1 cloning plasmid

• Catalog number
  CSB-CL010130HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the HAPLN1 gene.
• Specifications
  Gene name: HAPLN1; Gene ID: 1404; Accession number: BC057808; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1065; Sequence: atgaagagtctacttcttctggtgctgatttcaatctgctgggctgatcatctttcagacaactatactctggatcatgacagagctattcacatccaagcagaaaatggcccccatctacttgtggaagcagagcaagccaaggtgttttcacacagaggtggcaatgttacactgccatgtaaattttatcgagaccctacagcatttggctcaggaatccataaaatccgaattaagtggaccaagctaacttcggattacctcaaggaagtggatgtttttgtttccatgggataccacaaaaaaacctatggaggctaccagggtagagtgtttctgaagggaggcagtgatagtgatgcttctctggtcatcacagacctcactctggaagattatgggagatataagtgtgaggtgattgaaggattagaagatgatactgttgtggtagcactggacttacaaggtgtggtattcccttactttccacgactggggcgctacaatctcaattttcacgaggcgcagcaggcgtgtctggaccaggatgctgtgatcgcctccttcgaccagctgtacgacgcctggcggggcgggctggactggtgcaatgccggctggctcagtgatggctctgtgcaatatcccatcacaaagcccagagagccctgtgggggccagaacacagtgcccggagtcaggaactacggattttgggataaagataaaagcagatatgatgttttctgttttacatccaatttcaatggccgtttttactatctgatccaccccaccaaactgacctatgatgtagcggtgcaagcttgtctcaatgatggtgctcagattgcaaaagtgggccagatatttgctgcctggaaaattctcggatatgaccgctgtgatgcgggctggttggcggatggcagcgtccgctaccccatctctaggccaagaaggcgctgcagtcctactgaggctgcagtgcgcttcgtgggtttcccagataaaaagcataagctgtatggtgtctactgcttcagagcatacaactga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  HAPLN1   cloning  
• Gene symbol
  HAPLN1
• Short name
  HAPLN1 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  hyaluronan and proteoglycan link protein 1 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  hyaluronan and proteoglycan link protein 1, CRTL1, HAPLN1 and IDBG-32476 and ENSG00000145681 and 1404, hyaluronic acid binding, Extracellular, Hapln1 and IDBG-170841 and ENSMUSG00000021613 and 12950, HAPLN1 and IDBG-646525 and ENSBTAG00000012411 and 281717

Gene info

• Identity
  HGNC:2380
• Gene
  HAPLN1
• Long gene name
  hyaluronan and proteoglycan link protein 1
• Synonyms gene
  • CRTL1
• Synonyms gene name
  • cartilage linking protein 1
• Synonyms name
  • Cartilage link protein
  • hyaluronan and proteoglycan link protein 1
• Locus
  5q14.3
• Discovery year
  1990-03-14
• Entrez gene record
  1404
• Pubmed identfication
  • 2286376
  • 2320422
• RefSeq identity
  • NM_001884
• Classification
  • V-set domain containing
• VEGA ID
  OTTHUMG00000119045

Similar products