HAMP cloning plasmid
-
Catalog numberCSB-CL010124HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the HAMP gene.
-
SpecificationsGene name: HAMP; Gene ID: 57817; Accession number: BC020612; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 255; Sequence: atggcactgagctcccagatctgggccgcttgcctcctgctcctcctcctcctcgccagcctgaccagtggctctgttttcccacaacagacgggacaacttgcagagctgcaaccccaggacagagctggagccagggccagctggatgcccatgttccagaggcgaaggaggcgagacacccacttccccatctgcattttctgctgcggctgctgtcatcgatcaaagtgtgggatgtgctgcaagacgtag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolHAMP
-
Short nameHAMP cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namehepcidin antimicrobial peptide cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targethepcidin antimicrobial peptide, HAMP and IDBG-43921 and ENSG00000105697 and 57817, hormone activity, Extracellular, HAMP and IDBG-635586 and ENSBTAG00000017042 and 512301
-
Gene info
-
Identity
-
Gene
-
Long gene namehepcidin antimicrobial peptide
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2001-05-29
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID
-
Locus Specific Databases