GOLGA4 cloning plasmid
-
Catalog numberCSB-CL621670HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the GOLGA4 gene.
-
SpecificationsGene name: GOLGA4; Gene ID: 2803; Accession number: BC050444; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 501; Sequence: atgttcaagaaactgaagcaaaagatcagcgaggagcagcagcagctccagcaggcgctggctcctgctcaggcgtcctccaattcttcaacaccaacaagaatgaggagcaggacatcttcatttacagagcaacttgatgaaggtacacccaatagagagtcaggtgacacacagtcttttgcacagaagctccagctccgggtgccctccgtggagtctttgtttcgaagtccgataaaggaatctctattccggtcttcttctaaagagtctttggtacgaacatcttccagagaatccctgaatcgacttgacctggacagttctactgccagttttgatccaccctctgatatggatagcgaggctgaagacttggtagggaattcagacagtctcaacaaagaacagttgattcagcggttgcgaagaatggaacgaagcttaagtagctacaggggaaaatattctgagtcatggctccgatcttcatcttga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolGOLGA4-AS1, GOLGA4
-
Short nameGOLGA4 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameGOLGA4 cloning plasmid
-
Alternative techniqueplasmids
-
Gene info
-
Identity
-
Gene
-
Long gene nameGOLGA4 antisense RNA 1
-
Locus
-
Discovery year2020-09-29
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Antisense RNAs
Gene info
-
Identity
-
Gene
-
Long gene namegolgin A4
-
Synonyms gene name
- golgi autoantigen, golgin subfamily a, 4
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1997-11-05
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Golgins
-
VEGA ID