GAD1 cloning plasmid
-
Catalog numberCSB-CL858702HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the GAD1 gene.
-
SpecificationsGene name: GAD1; Gene ID: 2571; Accession number: BC002815; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 675; Sequence: atggcgtcttcgaccccatcttcgtccgcaacctcctcgaacgcgggagcggaccccaataccactaacctgcgccccacaacgtacgatacctggtgcggcgtggcccatggatgcaccagaaaactggggctcaagatctgcggcttcttgcaaaggaccaacagcctggaagagaagagtcgccttgtgagtgccttcaaggagaggcaatcctccaagaacctgctttcctgtgaaaacagcgaccgggatgcccgcttccggcgcacagagactgacttctctaatctgtttgctagagatctgcttccggctaagaacggtgaggagcaaaccgtgcaattcctcctggaagtggtggacatactcctcaactatgtccgcaagacatttgatcgctccaccaaggtgctggactttcatcacccacaccagttgctggaaggcatggagggcttcaacttggagctctctgaccaccccgagtccctggagcagatcctggttgactgcagagacaccttgaagtatggggttcgcacaggtcatcctcgatttttcaaccagctctccactggattggatattattggcctagctggagaatggctgacatcaacggccaataccaacatgccatcagacatgagggagtgttggttgctacggtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolGAD1
-
Short nameGAD1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameglutamate decarboxylase 1 (brain, 67kDa) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetglutamate decarboxylase 1 (brain, 67kDa), CPSQ1 and GAD and SCP, GAD1 and IDBG-74724 and ENSG00000128683 and 2571, protein N-terminus binding, Plasma membranes, Gad1 and IDBG-177867 and ENSMUSG00000070880 and 14415, GAD1 and IDBG-640815 and ENSBTAG00000007258 and 517552
-
Gene info
-
Identity
-
Gene
-
Long gene nameglutamate decarboxylase 1
-
Synonyms gene
-
Synonyms gene name
- glutamate decarboxylase 1 (brain, 67kD)
- glutamate decarboxylase 1 (brain, 67kDa)
-
Locus
-
Discovery year1986-01-01
-
Entrez gene record
-
Pubmed identfication
-
VEGA ID