FRZB cloning plasmid
-
Catalog numberCSB-CL835696HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the FRZB gene.
-
SpecificationsGene name: FRZB; Gene ID: 2487; Accession number: BC027855; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 978; Sequence: atggtctgcggcagcccgggagggatgctgctgctgcgggccgggctgcttgccctggctgctctctgcctgctccgggtgcccggggctcgggctgcagcctgtgagcccgtccgcatccccctgtgcaagtccctgccctggaacatgactaagatgcccaaccacctgcaccacagcactcaggccaacgccatcctggccatcgagcagttcgaaggtctgctgggcacccactgcagccccgatctgctcttcttcctctgtgccatgtacgcgcccatctgcaccattgacttccagcacgagcccatcaagccctgtaagtctgtgtgcgagcgggcccggcagggctgtgagcccatactcatcaagtaccgccactcgtggccggagaacctggcctgcgaggagctgccagtgtacgacaggggcgtgtgcatctctcccgaggccatcgttactgcggacggagctgattttcctatggattctagtaacggaaactgtagaggggcaagcagtgaacgctgtaaatgtaagcctattagagctacacagaagacctatttccggaacaattacaactatgtcattcgggctaaagttaaagagataaagactaagtgccatgatgtgactgcagtagtggaggtgaaggagattctaaagtcctctctggtaaacattccacgggacactgtcaacctctataccagctctggctgcctctgccctccacttaatgttaatgaggaatatatcatcatgggctatgaagatgaggaacgttccagattactcttggtggaaggctctatagctgagaagtggaaggatcgactcggtaaaaaagttaagcgctgggatatgaagcttcgtcatcttggactcagtaaaagtgattctagcaatagtgattccactcagagtcagaagtctggcaggaactcgaacccccggcaagcacgcaactaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolFRZB, SFRP4
-
Short nameFRZB cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namefrizzled-related protein cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetfrizzled-related protein, FRE and FRITZ and FRP-3 and FRZB-1 and FRZB-PEN and FRZB1 and FZRB and hFIZ and OS1 and SFRP3 and SRFP3, FRZB and IDBG-76878 and ENSG00000162998 and 2487, Wnt-activated receptor activity, Extracellular, Frzb and IDBG-183775 and ENSMUSG00000027004 and 20378, FRZB and IDBG-639871 and ENSBTAG00000010977 and 281170
-
Gene info
-
Identity
-
Gene
-
Long gene namefrizzled related protein
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1998-07-15
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Secreted frizzled-related proteins
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene namesecreted frizzled related protein 4
-
Synonyms gene name
- secreted frizzled-related protein 4
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1998-07-15
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Secreted frizzled-related proteins
-
VEGA ID