FCRL2 cloning plasmid
-
Catalog numberCSB-CL853454HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the FCRL2 gene.
-
SpecificationsGene name: FCRL2; Gene ID: 79368; Accession number: BC069185; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 609; Sequence: atgctgctgtggtcattgctggtcatctttgatgcagtcactgaacaggcagattcgctgacccttgtggcgccctcttctgtcttcgaaggagacagcatcgttctgaaatgccagggagaacagaactggaaaattcagaagatggcttaccataaggataacaaagagttatctgttttcaaaaaattctcagatttccttatccaaagtgcagttttaagtgacagtggtaactatttctgtagtaccaaaggacaactctttctctgggataaaacttcaaatatagtaaagataaaagtccaaggacctgatggctatagaagagacctcatgacagctggagttctctggggactgtttggtgtccttggtttcactggtgttgctttgctgttgtatgccttgttccacaagatatcaggagaaagttctgccactaatgaacccagaggggcttccaggccaaatcctcaagagttcacctattcaagcccaaccccagacatggaggagctgcagccagtgtatgtcaatgcaaacatcaggacacttctggagaacaaggactcccaagtcatctactcttctgtgaagaaatcataa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolFCRL2, FCRLB
-
Short nameFCRL2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namefragment c receptor-like 2 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetFc receptor-like 2, FCRL2 and IDBG-103696 and ENSG00000132704 and 79368, protein binding, Plasma membranes, Fcrls and IDBG-157017 and ENSMUSG00000015852 and 80891, IDBG-631078 and IDBG-631078 and ENSBTAG00000017204 and 531264
-
Gene info
-
Identity
-
Gene
-
Long gene nameFc receptor like 2
-
Synonyms gene
-
Synonyms gene name
- SH2 domain-containing phosphatase anchor protein 1
- Fc receptor-like 2
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2001-04-06
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- CD molecules
- Immunoglobulin like domain containing
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameFc receptor like B
-
Synonyms gene
-
Synonyms gene name
- Fc receptor-like and mucin-like 2
- Fc receptor-like B
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2005-05-10
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Immunoglobulin like domain containing
-
VEGA ID