ERC1 cloning plasmid

• Catalog number
  CSB-CL007767HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the ERC1 gene.
• Specifications
  Gene name: ERC1; Gene ID: 23085; Accession number: BC005065; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 276; Sequence: atgcctaaacaagtggtctggcacgggcactggccagctgctctctccaagcaggtggcccagatcccacccacgtggactttctcatcaggtgcagcgcctgccactctcagccactgggtgtgtgactctcctcttcatctcagcattctccatcacttcccctccagaaaaacggatggaaggaagccctctgtgacactgcttctgagaagaagcatttccgggaccgatatcatctgtctggtctctgtgaacagcaaggaatcttcttga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  ERC1   cloning  
• Gene symbol
  ERC1
• Short name
  ERC1 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  ELKS/RAB6-interacting/CAST family member 1 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  ELKS/RAB6-interacting/CAST family member 1, Cast2 and ELKS and ERC-1 and RAB6IP2, ERC1 and IDBG-11681 and ENSG00000082805 and 23085, leucine zipper domain binding, Plasma membranes, Erc1 and IDBG-182789 and ENSMUSG00000030172 and 111173, ERC1 and IDBG-641062 and ENSBTAG00000013658 and 519271

Gene info

• Identity
  HGNC:17072
• Gene
  ERC1
• Long gene name
  ELKS/RAB6-interacting/CAST family member 1
• Synonyms gene
  • RAB6IP2
• Synonyms gene name
  • RAB6 interacting protein 2
• Synonyms
  • ELKS
  • KIAA1081
  • CAST2
  • MGC12974
• GenBank acession
  • AB015617
• Locus
  12p13.33
• Discovery year
  2004-11-26
• Entrez gene record
  23085
• Pubmed identfication
  • 10697956
  • 11929610
• RefSeq identity
  • NM_015064
• VEGA ID
  OTTHUMG00000130138

Similar products