ERC1 cloning plasmid
-
Catalog numberCSB-CL007767HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the ERC1 gene.
-
SpecificationsGene name: ERC1; Gene ID: 23085; Accession number: BC005065; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 276; Sequence: atgcctaaacaagtggtctggcacgggcactggccagctgctctctccaagcaggtggcccagatcccacccacgtggactttctcatcaggtgcagcgcctgccactctcagccactgggtgtgtgactctcctcttcatctcagcattctccatcacttcccctccagaaaaacggatggaaggaagccctctgtgacactgcttctgagaagaagcatttccgggaccgatatcatctgtctggtctctgtgaacagcaaggaatcttcttga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolERC1
-
Short nameERC1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameELKS/RAB6-interacting/CAST family member 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetELKS/RAB6-interacting/CAST family member 1, Cast2 and ELKS and ERC-1 and RAB6IP2, ERC1 and IDBG-11681 and ENSG00000082805 and 23085, leucine zipper domain binding, Plasma membranes, Erc1 and IDBG-182789 and ENSMUSG00000030172 and 111173, ERC1 and IDBG-641062 and ENSBTAG00000013658 and 519271
-
Gene info
-
Identity
-
Gene
-
Long gene nameELKS/RAB6-interacting/CAST family member 1
-
Synonyms gene
-
Synonyms gene name
- RAB6 interacting protein 2
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2004-11-26
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID