EAF2 cloning plasmid
-
Catalog numberCSB-CL856910HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the EAF2 gene.
-
SpecificationsGene name: EAF2; Gene ID: 55840; Accession number: BC014209; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 783; Sequence: atgaatagcgcagcgggattctcacacctagaccgtcgcgagcgggttctcaagttaggggagagtttcgagaagcagccgcgctgcgccttccacactgtgcgctatgacttcaaacctgcttctattgacacttcttctgaaggataccttgaggttggtgaaggtgaacaggtgaccataactctgccaaatatagaaggttcaactccaccagtaactgttttcaaaggttcaaaaaaaccttacttaaaagaatgcattttgattattaaccatgatactggagaatgtcggctagaaaaactcagcagcaacatcactgtaaaaaaaacaagagttgaaggaagcagtaaaattcagtatcgtaaagaacaacagcaacaacaaatgtggaattcagccaggactcccaatcttgtaaaacattctccatctgaagataagatgtccccagcatctccaatagatgatatcgaaagagaactgaaggcagaagctagtctaatggaccagatgagtagttgtgatagttcatcagattccaaaagttcatcatcttcaagtagtgaggatagttctagtgactcagaagatgaagattgcaaatcctctacttctgatacagggaattgtgtctcaggacatcctaccatgacacagtacaggattcctgatatagatgccagtcataatagatttcgagacaacagtggccttctgatgaatactttaagaaatgatttgcagctgagtgaatcaggaagtgacagtgatgactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolEAF2, DMAP1
-
Short nameEAF2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameELL associated factor 2 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetELL associated factor 2, EAF2 and IDBG-52225 and ENSG00000145088 and 55840, protein binding, nuclei, Eaf2 and IDBG-158420 and ENSMUSG00000022838 and 106389, EAF2 and IDBG-633095 and ENSBTAG00000013070 and 613523
-
Gene info
-
Identity
-
Gene
-
Long gene nameELL associated factor 2
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2003-09-17
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameDNA methyltransferase 1 associated protein 1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2003-03-12
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Myb/SANT domain containing
- SRCAP complex
-
VEGA ID