DOC2A cloning plasmid

• Catalog number
  CSB-CL617905HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the DOC2A gene.
• Specifications
  Gene name: DOC2A; Gene ID: 8448; Accession number: BC063436; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1203; Sequence: atgaggggccgcaggggcgatcgcatgaccatcaacatccaggagcacatggccatcaacgtgtgccccgggcccatccggcccatccgccagatctctgactacttcccccggggaccaggacctgaagggggcggcgggagcggcggggaggcccccgcccatctggtccccctggctctggccccccctgcagccctccttggggccaccacgcctgaggatggtgcggaggtggacagctatgactcggatgatgccaccgccctaggcacgctggagtttgaccttctctacgaccgggcctcctgcactctgcactgtagcatcctcagggccaagggcctcaagcccatggatttcaatggcctcgccgacccctacgtcaagctgcacttgctgcctggagcctgtaaggccaataagctaaaaacgaagactcagaggaacacactgaatcccgtgtggaatgaggacctgacttacagcgggatcacagatgacgacatcacgcacaaggtgctcaggatcgccgtctgtgatgaggacaagctgagtcacaatgagtttattggggagatccgcgtgcccctccgccgcctcaagccttcgcagaagaagcattttaacatctgcctcgagcgccaagtcccgctggcgtccccctcttccatgtcagcggcgctgaggggcatctcctgttatctgaaggagttggagcaggcggagcaggggcaggggctgctggaggagcgtggccgcatcctgctgagtctcagctacagctcgcggcgccggggactgctggtaggcatcttgcgctgcgcccatctggctgccatggacgtcaacggttactcggacccctacgtcaagacgtacctgaggcccgatgtggacaagaaatccaagcataagacgtgtgtgaagaagaagactctcaacccagaatttaacgaggagtttttctacgagatagagctctccactctggccaccaagaccctggaagtcaccgtctgggactatgacattggcaaatccaatgacttcattggtggcgtgtccctggggccaggtgcccgaggcgaggctcggaagcactggagtgactgcctgcagcagccggacgcagccctggagcgctggcacaccctgaccagtgagctgccccctgcggccggggctctgtcctcagcctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  DOC2A   cloning  
• Gene symbol
  DOC2A
• Short name
  DOC2A cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  double complement component 2-like domains, alpha cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  double C2-like domains, alpha, Doc2, DOC2A and IDBG-25372 and ENSG00000149927 and 8448, calcium-dependent phospholipid binding, Cell surfaces, Doc2a and IDBG-209883 and ENSMUSG00000052301 and 13446, DOC2A and IDBG-639237 and ENSBTAG00000005031 and 528120

Gene info

• Identity
  HGNC:2985
• Gene
  DOC2A
• Long gene name
  double C2 domain alpha
• Synonyms gene name
  • double C2-like domains, alpha
• GenBank acession
  • D31897
• Locus
  16p11.2
• Discovery year
  1998-10-30
• Entrez gene record
  8448
• Pubmed identfication
  • 7826360
  • 9736751
• RefSeq identity
  • NM_003586
• Classification
  • Synaptotagmin like tandem C2 proteins
• VEGA ID
  OTTHUMG00000132109

Similar products