DNASE1L3 cloning plasmid
-
Catalog numberCSB-CL621686HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the DNASE1L3 gene.
-
SpecificationsGene name: DNASE1L3; Gene ID: 1776; Accession number: BC015831; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 918; Sequence: atgtcacgggagctggccccactgctgcttctcctcctctccatccacagcgccctggccatgaggatctgctccttcaacgtcaggtcctttggggaaagcaagcaggaagacaagaatgccatggatgtcattgtgaaggtcatcaaacgctgtgacatcatactcgtgatggaaatcaaggacagcaacaacaggatctgccccatactgatggagaagctgaacagaaattcaaggagaggcataacgtacaactatgtgattagctctcggcttggaagaaacacatataaagaacaatatgcctttctctacaaggaaaagctggtgtctgtgaagaggagttatcactaccatgactatcaggatggagacgcagatgtgttttccagggagccctttgtggtctggttccaatctccccacactgctgtcaaagacttcgtgattatccccctgcacaccaccccagagacatccgttaaggagatcgatgagttggttgaggtctacacggacgtgaaacaccgctggaaggcggagaatttcattttcatgggtgacttcaatgccggctgcagctacgtccccaagaaggcctggaagaacatccgcttgaggactgaccccaggtttgtttggctgatcggggaccaagaggacaccacggtgaagaagagcaccaactgtgcatatgacaggattgtgcttagaggacaagaaatcgtcagttctgttgttcccaagtcaaacagtgtttttgacttccagaaagcttacaagctgactgaagaggaggccctggatgtcagcgaccactttccagttgaatttaaactacagtcttcaagggccttcaccaacagcaaaaaatctgtcactctaaggaagaaaacaaagagcaaacgctcctag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolDNASE1L3
-
Short nameDNASE1L3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namedeoxyribonuclease I-like 3 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetdeoxyribonuclease I-like 3, DHP2 and DNAS1L3 and LSD and SLEB16, DNASE1L3 and IDBG-42007 and ENSG00000163687 and 1776, endodeoxyribonuclease activity, nuclei, Dnase1l3 and IDBG-131491 and ENSMUSG00000025279 and 13421, DNASE1L3 and IDBG-645218 and ENSBTAG00000018294 and 512512,784519
-
Gene info
-
Identity
-
Gene
-
Long gene namedeoxyribonuclease 1 like 3
-
Synonyms gene name
- deoxyribonuclease I like 3
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1997-05-15
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID