DDIT4 cloning plasmid
-
Catalog numberCSB-CL889135HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the DDIT4 gene.
-
SpecificationsGene name: DDIT4; Gene ID: 54541; Accession number: BC007714; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 699; Sequence: atgcctagcctttgggaccgcttctcgtcgtcgtccacctcctcttcgccctcgtccttgccccgaactcccaccccagatcggccgccgcgctcagcctgggggtcggcgacccgggaggaggggtttgaccgctccacgagcctggagagctcggactgcgagtccctggacagcagcaacagtggcttcgggccggaggaagacacggcttacctggatggggtgtcgttgcccgacttcgagctgctcagtgaccctgaggatgaacacttgtgtgccaacctgatgcagctgctgcaggagagcctggcccaggcgcggctgggctctcgacgccctgcgcgcctgctgatgcctagccagttggtaagccaggtgggcaaagaactactgcgcctggcctacagcgagccgtgcggcctgcggggggcgctgctggacgtctgcgtggagcagggcaagagctgccacagcgtgggccagctggcactcgaccccagcctggtgcccaccttccagctgaccctcgtgctgcgcctggactcacgactctggcccaagatccaggggctgtttagctccgccaactctcccttcctccctggcttcagccagtccctgacgctgagcactggcttccgagtcatcaagaagaagctgtacagctcggaacagctgctcattgaggagtgttga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolDDIT4-AS1, DDIT4
-
Short nameDDIT4 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameDesoxyribonucleic acid-damage-inducible transcript 4 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetDNA-damage-inducible transcript 4, DDIT4 and IDBG-77884 and ENSG00000168209 and 54541, 14-3-3 protein binding, Cytoplasm, Ddit4 and IDBG-154242 and ENSMUSG00000020108 and 74747, DDIT4 and IDBG-629952 and ENSBTAG00000000163 and 529235
-
Gene info
-
Identity
-
Gene
-
Long gene nameDDIT4 antisense RNA 1
-
Synonyms
-
Locus
-
Discovery year2017-06-19
-
Pubmed identfication
-
Classification
- Antisense RNAs
Gene info
-
Identity
-
Gene
-
Long gene nameDNA damage inducible transcript 4
-
Synonyms gene name
- DNA-damage-inducible transcript 4
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2004-02-12
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID