DARC cloning plasmid

• Catalog number
  CSB-CL624105HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the DARC gene.
• Specifications
  Gene name: DARC; Gene ID: 2532; Accession number: BC017817; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1011; Sequence: atggggaactgtctgcacagggcggagctctccccctcaactgagaactcaagtcagctggacttcgaagatgtatggaattcttcctatggtgtgaatgattccttcccagatggagactatggtgccaacctggaagcagctgccccctgccactcctgtaacctgctggatgactctgcactgcccttcttcatcctcaccagtgtcctgggtatcctagctagcagcactgtcctcttcatgcttttcagacctctcttccgctggcagctctgccctggctggcctgtcctggcacagctggctgtgggcagtgccctcttcagcattgtggtgcccgtcttggccccagggctaggtagcactcgcagctctgccctgtgtagcctgggctactgtgtctggtatggctcagcctttgcccaggctttgctgctagggtgccatgcctccctgggccacagactgggtgcaggccaggtcccaggcctcaccctggggctcactgtgggaatttggggagtggctgccctactgacactgcctgtcaccctggccagtggtgcttctggtggactctgcaccctgatatacagcacggagctgaaggctttgcaggccacacacactgtagcctgtcttgccatctttgtcttgttgccattgggtttgtttggagccaaggggctgaagaaggcattgggtatggggccaggcccctggatgaacatcctgtgggcctggtttattttctggtggcctcatggggtggttctaggactggatttcctggtgaggtccaagctgttgctgttgtcaacatgtctggcccagcaggctctggacctgctgctgaacctggcagaagccctggcaattttgcactgtgtggctacgcccctgctcctcgccctattctgccaccaggccacccgcaccctcttgccctctctgcccctccctgaaggatggttttctcatctggacacccttggaagcaaatcctag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  DARC   cloning  
• Gene symbol
  ACKR1
• Short name
  DARC cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  Duffy blood group, chemokine receptor cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  Duffy blood group, chemokine receptor, CCBP1 and CD234 and DARC and Dfy and FY and GPD and GpFy and WBCQ1, DARC and IDBG-246055 and ENSG00000213088 and 2532, C-C chemokine binding, Plasma membranes, Darc and IDBG-205828 and ENSMUSG00000037872 and 13349, BT.27077 and IDBG-630777 and ENSBTAG00000003220 and 528076

Gene info

• Identity
  HGNC:4035
• Gene
  ACKR1
• Long gene name
  atypical chemokine receptor 1 (Duffy blood group)
• Synonyms gene
  • FY
  • DARC
• Synonyms gene name
  • Duffy blood group
  • Duffy blood group, chemokine receptor
  • Duffy blood group, atypical chemokine receptor
• Synonyms
  • CCBP1
  • GPD
  • Dfy
  • CD234
• Synonyms name
  • atypical chemokine receptor 1
  • glycoprotein D
• GenBank acession
  • U01839
• Locus
  1q23.2
• Discovery year
  2001-06-22
• Entrez gene record
  2532
• Pubmed identfication
  • 8248172
  • 7663520
  • 16148
• RefSeq identity
  • NM_002036
• Classification
  • Atypical chemokine receptors
  • Blood group antigens
  • CD molecules
• VEGA ID
  OTTHUMG00000037182
• Locus Specific Databases
  • LRG_801

Similar products