CXCL3 cloning plasmid
-
Catalog numberCSB-CL006249HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CXCL3 gene.
-
SpecificationsGene name: CXCL3; Gene ID: 2921; Accession number: BC016308; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 324; Sequence: atggcccacgccacgctctccgccgcccccagcaatccccggctcctgcgggtggcgctgctgctcctgctcctggtggccgccagccggcgcgcagcaggagcgtccgtggtcactgaactgcgctgccagtgcttgcagacactgcagggaattcacctcaagaacatccaaagtgtgaatgtaaggtcccccggaccccactgcgcccaaaccgaagtcatagccacactcaagaatgggaagaaagcttgtctcaaccccgcatcccccatggttcagaaaatcatcgaaaagatactgaacaaggggagcaccaactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCXCL3
-
Short nameCXCL3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namechemokine (C-X-C motif) ligand 3 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetchemokine (C-X-C motif) ligand 3, CINC-2b and GRO3 and GROg and MIP-2b and MIP2B and SCYB3, CXCL3 and IDBG-24221 and ENSG00000163734 and 2921, chemokine activity, Extracellular
-
Gene info
-
Identity
-
Gene
-
Long gene nameC-X-C motif chemokine ligand 3
-
Synonyms gene
-
Synonyms gene name
- GRO3 oncogene
- chemokine (C-X-C motif) ligand 3
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1991-05-21
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Chemokine ligands
-
VEGA ID