CMTM7 cloning plasmid
-
Catalog numberCSB-CL850296HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CMTM7 gene.
-
SpecificationsGene name: CMTM7; Gene ID: 112616; Accession number: BC010116; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 528; Sequence: atgtcgcacggagccgggctcgtccgcaccacgtgcagcagcggcagcgcgctcggacccggggccggcgcggcccagcccagcgcgagccccttggaggggctgctggacctcagctacccccgcacccacgcggccctgctgaaagtggcgcaaatggtcaccctgctgattgccttcatctgtgtgcggagctccctgtggaccaactacagcgcctacagctactttgaagtggtcaccatttgcgacttgataatgatcctcgccttttacctggtccacctcttccgcttctaccgcgtgctcacctgtatcagctggcccctgtcggaacttctgcactatttaatcggtaccctgctcctcctcatcgcctccattgtggcagcttccaagagttacaaccagagcggactggtagccggagcgatctttggtttcatggccaccttcctctgcatggcaagcatatggctgtcctataagatctcgtgtgtaacccagtccacagatgcagccgtctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCMTM7
-
Short nameCMTM7 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namechemokine-like factor-like MARVEL transmembrane domain containing 7 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetCKLF-like MARVEL transmembrane domain containing 7, CMTM7 and IDBG-23702 and ENSG00000153551 and 112616, cytokine activity, Extracellular, Cmtm7 and IDBG-203651 and ENSMUSG00000032436 and 102545, CMTM7 and IDBG-644108 and ENSBTAG00000001712 and 532269
-
Gene info
-
Identity
-
Gene
-
Long gene nameCKLF like MARVEL transmembrane domain containing 7
-
Synonyms gene
-
Synonyms gene name
- chemokine-like factor super family 7
- chemokine-like factor superfamily 7
- CKLF-like MARVEL transmembrane domain containing 7
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2002-09-10
-
Entrez gene record
-
Classification
- CKLF like MARVEL transmembrane domain containing
-
VEGA ID