CMTM7 cloning plasmid

• Catalog number
  CSB-CL850296HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the CMTM7 gene.
• Specifications
  Gene name: CMTM7; Gene ID: 112616; Accession number: BC010116; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 528; Sequence: atgtcgcacggagccgggctcgtccgcaccacgtgcagcagcggcagcgcgctcggacccggggccggcgcggcccagcccagcgcgagccccttggaggggctgctggacctcagctacccccgcacccacgcggccctgctgaaagtggcgcaaatggtcaccctgctgattgccttcatctgtgtgcggagctccctgtggaccaactacagcgcctacagctactttgaagtggtcaccatttgcgacttgataatgatcctcgccttttacctggtccacctcttccgcttctaccgcgtgctcacctgtatcagctggcccctgtcggaacttctgcactatttaatcggtaccctgctcctcctcatcgcctccattgtggcagcttccaagagttacaaccagagcggactggtagccggagcgatctttggtttcatggccaccttcctctgcatggcaagcatatggctgtcctataagatctcgtgtgtaacccagtccacagatgcagccgtctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  CMTM7   cloning  
• Gene symbol
  CMTM7
• Short name
  CMTM7 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  chemokine-like factor-like MARVEL transmembrane domain containing 7 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  CKLF-like MARVEL transmembrane domain containing 7, CMTM7 and IDBG-23702 and ENSG00000153551 and 112616, cytokine activity, Extracellular, Cmtm7 and IDBG-203651 and ENSMUSG00000032436 and 102545, CMTM7 and IDBG-644108 and ENSBTAG00000001712 and 532269

Gene info

• Identity
  HGNC:19178
• Gene
  CMTM7
• Long gene name
  CKLF like MARVEL transmembrane domain containing 7
• Synonyms gene
  • CKLFSF7
• Synonyms gene name
  • chemokine-like factor super family 7
  • chemokine-like factor superfamily 7
  • CKLF-like MARVEL transmembrane domain containing 7
• Synonyms
  • FLJ30992
• GenBank acession
  • AF479263
• Locus
  3p22.3
• Discovery year
  2002-09-10
• Entrez gene record
  112616
• Classification
  • CKLF like MARVEL transmembrane domain containing
• VEGA ID
  OTTHUMG00000155869

Similar products