CMTM3 cloning plasmid

• Catalog number
  CSB-CL836263HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the CMTM3 gene.
• Specifications
  Gene name: CMTM3; Gene ID: 123920; Accession number: BC023591; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 549; Sequence: atgtggcccccagaccccgaccccgacccggaccccgagcctgccggcggctcccgtcccggccccgcggtccccgggctccgcgccctgctgccggcgcgggctttcctctgctctctcaaaggccgcctcctgctggccgagtcgggtctctcattcatcacttttatctgctatgtggcgtcctcagcatctgccttcctcacagcgcctctgctggagttcctgctggccttgtacttcctctttgctgatgccatgcagctgaatgacaagtggcagggcttgtgctggcccatgatggacttcctgcgctgtgtcaccgcggccctcatctactttgctatctccatcacggccatcgccaagtactcggatggggcttccaaagccgctggggtgtttggcttctttgctaccatcgtgtttgcaactgatttctacctgatctttaacgacgtggccaaattcctcaaacaaggggactctgcagatgagaccacagcccacaagacagaagaagagaattccgactcggactctgactga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  CMTM3   cloning  
• Gene symbol
  CMTM3
• Short name
  CMTM3 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  chemokine-like factor-like MARVEL transmembrane domain containing 3 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  CKLF-like MARVEL transmembrane domain containing 3, CMTM3 and IDBG-35390 and ENSG00000140931 and 123920, protein binding, nuclei, Cmtm3 and IDBG-185361 and ENSMUSG00000031875 and 68119, CMTM3 and IDBG-633082 and ENSBTAG00000047654 and 787512

Gene info

• Identity
  HGNC:19174
• Gene
  CMTM3
• Long gene name
  CKLF like MARVEL transmembrane domain containing 3
• Synonyms gene
  • CKLFSF3
• Synonyms gene name
  • chemokine-like factor superfamily 3
  • CKLF-like MARVEL transmembrane domain containing 3
• Synonyms
  • FLJ31762
  • BNAS2
• GenBank acession
  • AK056324
• Locus
  16q22.1
• Discovery year
  2002-09-10
• Entrez gene record
  123920
• Pubmed identfication
  • 15087455
• RefSeq identity
  • NM_144601
• Classification
  • CKLF like MARVEL transmembrane domain containing
• VEGA ID
  OTTHUMG00000137503

Similar products