CD302 cloning plasmid
-
Catalog numberCSB-CL818249HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CD302 gene.
-
SpecificationsGene name: CD302; Gene ID: 9936; Accession number: BC020646; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 513; Sequence: atgataagcatacataatgaagaagaaaatgcttttatactggatactttgaaaaagcaatggaaaggcccagatgatatcctactaggcatgttttatgacacagatgatgcgagtttcaagtggtttgataattcaaatatgacatttgataagtggacagaccaagatgatgatgaggatttagttgacacctgtgcttttctgcacatcaagacaggtgaatggaaaaaaggaaattgtgaagtttcttctgtggaaggaacactatgcaaaacagctatcccatacaaaaggaaatatttatcagataaccacattttaatatcagcattggtgattgctagcacggtaattttgacagttttgggagcaatcatttggttcctgtacaaaaaacattctgattctcgtttcaccacagttttttcaaccgcaccccaatcaccttataatgaagactgtgttttggtagttggagaagaaaatgaatatcctgttcaatttgactaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolLY75-CD302, CD302
-
Short nameCD302 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameCD302 molecule cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetCD302 molecule, BIMLEC and CLEC13A and DCL-1 and DCL1, CD302 and IDBG-403891 and ENSG00000241399 and 9936, carbohydrate binding, Plasma membranes, Cd302 and IDBG-172983 and ENSMUSG00000060703 and 66205, CD302 and IDBG-641458 and ENSBTAG00000038195 and 100126272
-
Gene info
-
Identity
-
Gene
-
Long gene nameLY75-CD302 readthrough
-
Locus
-
Discovery year2011-04-19
-
Entrez gene record
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameCD302 molecule
-
Synonyms gene name
- CD302 antigen
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2005-02-11
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- C-type lectin domain containing
- CD molecules
-
VEGA ID