CD27 cloning plasmid

  • Catalog number
    CSB-CL004910HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the CD27 gene.
  • Specifications
    Gene name: CD27; Gene ID: 939; Accession number: BC012160; Vector: pENTR223.1
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 783; Sequence: atggcacggccacatccctggtggctgtgcgttctggggaccctggtggggctctcagctactccagcccccaagagctgcccagagaggcactactgggctcagggaaagctgtgctgccagatgtgtgagccaggaacattcctcgtgaaggactgtgaccagcatagaaaggctgctcagtgtgatccttgcataccgggggtctccttctctcctgaccaccacacccggccccactgtgagagctgtcggcactgtaactctggtcttctcgttcgcaactgcaccatcactgccaatgctgagtgtgcctgtcgcaatggctggcagtgcagggacaaggagtgcaccgagtgtgatcctcttccaaacccttcgctgaccgctcggtcgtctcaggccctgagcccacaccctcagcccacccacttaccttatgtcagtgagatgctggaggccaggacagctgggcacatgcagactctggctgacttcaggcagctgcctgcccggactctctctacccactggccaccccaaagatccctgtgcagctccgattttattcgcatccttgtgatcttctctggaatgttccttgttttcaccctggccggggccctgttcctccatcaacgaaggaaatatagatcaaacaaaggagaaagtcctgtggagcctgcagagccttgtcgttacagctgccccagggaggaggagggcagcaccatccccatccaggaggattaccgaaaaccggagcctgcctgctccccctga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    CD27   cloning  
  • Gene symbol
    CD27-AS1, CD27
  • Short name
    CD27 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    CD27 molecule cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    CD27 molecule, S152 and S152. LPFS2 and T14 and TNFRSF7 and Tp55, CD27 and IDBG-14014 and ENSG00000139193 and 939, cysteine-type endopeptidase inhibitor activity involved in apoptotic process, Extracellular, Cd27 and IDBG-189750 and ENSMUSG00000030336 and 21940, CD27 and IDBG-640494 and ENSBTAG00000014725 and 512514
Gene info
Gene info
  • Identity
  • Gene
  • Long gene name
    CD27 molecule
  • Synonyms gene
  • Synonyms gene name
    • tumor necrosis factor receptor superfamily, member 7
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    1992-06-10
  • Entrez gene record
    939
  • Pubmed identfication
  • Classification
    • Tumor necrosis factor receptor superfamily
    • CD molecules
  • VEGA ID
  • Locus Specific Databases
Similar products
Filters
Contact
Chat with gentaur.com employee