CD27 cloning plasmid
-
Catalog numberCSB-CL004910HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CD27 gene.
-
SpecificationsGene name: CD27; Gene ID: 939; Accession number: BC012160; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 783; Sequence: atggcacggccacatccctggtggctgtgcgttctggggaccctggtggggctctcagctactccagcccccaagagctgcccagagaggcactactgggctcagggaaagctgtgctgccagatgtgtgagccaggaacattcctcgtgaaggactgtgaccagcatagaaaggctgctcagtgtgatccttgcataccgggggtctccttctctcctgaccaccacacccggccccactgtgagagctgtcggcactgtaactctggtcttctcgttcgcaactgcaccatcactgccaatgctgagtgtgcctgtcgcaatggctggcagtgcagggacaaggagtgcaccgagtgtgatcctcttccaaacccttcgctgaccgctcggtcgtctcaggccctgagcccacaccctcagcccacccacttaccttatgtcagtgagatgctggaggccaggacagctgggcacatgcagactctggctgacttcaggcagctgcctgcccggactctctctacccactggccaccccaaagatccctgtgcagctccgattttattcgcatccttgtgatcttctctggaatgttccttgttttcaccctggccggggccctgttcctccatcaacgaaggaaatatagatcaaacaaaggagaaagtcctgtggagcctgcagagccttgtcgttacagctgccccagggaggaggagggcagcaccatccccatccaggaggattaccgaaaaccggagcctgcctgctccccctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCD27-AS1, CD27
-
Short nameCD27 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameCD27 molecule cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetCD27 molecule, S152 and S152. LPFS2 and T14 and TNFRSF7 and Tp55, CD27 and IDBG-14014 and ENSG00000139193 and 939, cysteine-type endopeptidase inhibitor activity involved in apoptotic process, Extracellular, Cd27 and IDBG-189750 and ENSMUSG00000030336 and 21940, CD27 and IDBG-640494 and ENSBTAG00000014725 and 512514
-
Gene info
-
Identity
-
Gene
-
Long gene nameCD27 antisense RNA 1
-
Synonyms gene name
- CD27 antisense RNA 1 (non-protein coding)
-
GenBank acession
-
Locus
-
Discovery year2012-04-27
-
Entrez gene record
-
RefSeq identity
-
Classification
- Antisense RNAs
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameCD27 molecule
-
Synonyms gene
-
Synonyms gene name
- tumor necrosis factor receptor superfamily, member 7
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1992-06-10
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Tumor necrosis factor receptor superfamily
- CD molecules
-
VEGA ID
-
Locus Specific Databases