CD247 cloning plasmid

• Catalog number
  CSB-CL004904HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the CD247 gene.
• Specifications
  Gene name: CD247; Gene ID: 919; Accession number: BC025703; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 495; Sequence: atgaagtggaaggcgcttttcaccgcggccatcctgcaggcacagttgccgattacagaggcacagagctttggcctgctggatcccaaactctgctacctgctggatggaatcctcttcatctatggtgtcattctcactgccttgttcctgagagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgcagagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgctaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  CD247   cloning  
• Gene symbol
  CD247
• Short name
  CD247 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  CD247 molecule cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  CD247 molecule, CD3-ZETA and CD3H and CD3Q and CD3Z and IMD25 and T3Z and TCRZ, CD247 and IDBG-104547 and ENSG00000198821 and 919, protein homodimerization activity, Plasma membranes, Cd247 and IDBG-202777 and ENSMUSG00000005763 and 12503, CD247 and IDBG-629556 and ENSBTAG00000012700 and 281056

Gene info

• Identity
  HGNC:1677
• Gene
  CD247
• Long gene name
  CD247 molecule
• Synonyms gene
  • CD3Z
• Synonyms gene name
  • CD3z antigen, zeta polypeptide (TiT3 complex)
  • CD247 antigen
• Synonyms
  • CD3H
  • CD3Q
• Synonyms name
  • T-cell surface glycoprotein CD3 zeta chain
• GenBank acession
  • BC025703
• Locus
  1q24.2
• Discovery year
  1989-04-06
• Entrez gene record
  919
• Pubmed identfication
  • 2974162
• RefSeq identity
  • NM_198053
• Classification
  • CD molecules
• VEGA ID
  OTTHUMG00000034593
• Locus Specific Databases
  • CD247base: Mutation registry for Autosomal recessive CD3Zeta deficiency
  • LRG_36

Similar products