CCM2 cloning plasmid
-
Catalog numberCSB-CL866275HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CCM2 gene.
-
SpecificationsGene name: CCM2; Gene ID: 83605; Accession number: BC063663; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 216; Sequence: atggaagaggagggcaagaagggcaagaagcctggaattgtctcgccatttaaacgagtattcctaaaaggtgaaaagagtagagataagaaagcccatgagaaggtgacagagaggcgccctctgcacactgtggtgttgtcattgcctgagcgcgtcgagccagacagactgctgagcgactatattgagaaggaggtaaagggctcccattaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCCM2
-
Short nameCCM2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namecerebral cavernous malformation 2 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetcerebral cavernous malformation 2, CCM2 and IDBG-15466 and ENSG00000136280 and 83605, protein binding, Cytoplasm, Ccm2 and IDBG-148293 and ENSMUSG00000000378 and 216527, CCM2 and IDBG-634072 and ENSBTAG00000008090 and 506450
-
Gene info
-
Identity
-
Gene
-
Long gene nameCCM2 scaffold protein
-
Synonyms gene
-
Synonyms gene name
- chromosome 7 open reading frame 22
- cerebral cavernous malformation 2
- CCM2 scaffolding protein
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2003-07-14
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- CCM adhesion complex
-
VEGA ID
-
Locus Specific Databases