CCL20 cloning plasmid
-
Catalog numberCSB-CL004784HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CCL20 gene.
-
SpecificationsGene name: CCL20; Gene ID: 6364; Accession number: BC020698; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 288; Sequence: atgtgctgtaccaagagtttgctcctggctgctttgatgtcagtgctgctactccacctctgcggcgaatcagaagcaagcaactttgactgctgtcttggatacacagaccgtattcttcatcctaaatttattgtgggcttcacacggcagctggccaatgaaggctgtgacatcaatgctatcatctttcacacaaagaaaaagttgtctgtgtgcgcaaatccaaaacagacttgggtgaaatatattgtgcgtctcctcagtaaaaaagtcaagaacatgtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCCL20
-
Short nameCCL20 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namechemokine (C-C motif) ligand 20 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetchemokine (C-C motif) ligand 20, CKb4 and Exodus and LARC and MIP-3-alpha and MIP-3a and MIP3A and SCYA20 and ST38, CCL20 and IDBG-82684 and ENSG00000115009 and 6364, chemokine activity, Extracellular, Ccl20 and IDBG-174322 and ENSMUSG00000026166 and 20297, CCL20 and IDBG-644271 and ENSBTAG00000021326 and 281666
-
Gene info
-
Identity
-
Gene
-
Long gene nameC-C motif chemokine ligand 20
-
Synonyms gene
-
Synonyms gene name
- small inducible cytokine subfamily A (Cys-Cys), member 20
- chemokine (C-C motif) ligand 20
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1997-02-10
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Chemokine ligands
-
VEGA ID