BRF1 cloning plasmid
-
Catalog numberCSB-CL852925HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the BRF1 gene.
-
SpecificationsGene name: BRF1; Gene ID: 2972; Accession number: BC016743; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 627; Sequence: atgacgggccgcgtgtgccgcggttgcggcggcacggacatcgagctggacgcggcgcgcggggacgcggtgtgcaccgcctgcggctcagtgctggaggacaacatcatcgtgtccgaggtgcagttcgtggagagcagcggcggcggctcctcggccgtgggccagttcgtgtccctggacggtgctggcaaaaccccgactctgggtggcggcttccacgtgaatctggggaaggagtcgagagcgcagaccctgcagaatgggaggcgccacatccaccacctggggaaccagctgcagctgaaccagcactgcctggacaccgccttcaacttcttcaagatggccgtgagcaggcacctgacccgcggccggaagatggcccacgtgattgctgcctgcctctacctggtctgccgtacggagggcacgccgcacatgctcctggacctcagcgacctgctccaggtagacagcctccgtcctgcatctttccccacctggggttgtgacctgggggttgtgaccagggttgtgaccggggtgtaccccaggtgcctccacgcatctcagtggccggtctgtgctgcctgcccggtcaggaagttttggtctgtaggatga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolBRF1, ZFP36L1
-
Short nameBRF1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameBRF1 cloning plasmid
-
Alternative techniqueplasmids
-
Gene info
-
Identity
-
Gene
-
Long gene nameBRF1 RNA polymerase III transcription initiation factor subunit
-
Synonyms gene
-
Synonyms gene name
- TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2
- BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)
- BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1998-08-20
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- General transcription factor IIIB complex subunits
- General transcription factors
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameZFP36 ring finger protein like 1
-
Synonyms gene
-
Synonyms gene name
- zinc finger protein, C3H type, 36-like 1
- zinc finger protein 36, C3H type-like 1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1995-05-09
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Zinc fingers CCCH-type
-
VEGA ID