BOC cloning plasmid
-
Catalog numberCSB-CL866299HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the BOC gene.
-
SpecificationsGene name: BOC; Gene ID: 91653; Accession number: BC034614; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 474; Sequence: atgctgcgtgggacgatgacggcgtggagaggaatgaggcctgaggtcacactggcttgcctcctcctagccacagcaggctgctttgctgacttgaacgaggtccctcaggtcaccgtccagcctgcgtccaccgtccagaagcccggaggcactgtgatcttgggctgcgtggtggaacctccaaggatgaatgtaacctggcgcctgaatggaaaggagctgaatggctcggatgatgctctgggtgtcctcatcacccacgggaccctcgtcatcactgcccttaacaaccacactgtgggacggtaccagtgtgtggcccggatgcctgcgggggctgtggccagcgtgccagccactgtgacactagccagtgagtctgctcctttgcctccctgccatggtgcggtccctcctcatctctcccaccctgaagcccccaccattcatgctgcctcttgttactcttag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolBOC
-
Short nameBOC cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameBoc homolog (mouse) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetBoc homolog (mouse), BOC and IDBG-50192 and ENSG00000144857 and 91653, protein binding, Plasma membranes, Boc and IDBG-162156 and ENSMUSG00000022687 and 117606, BOC and IDBG-632359 and ENSBTAG00000013909 and 512018
-
Gene info
-
Identity
-
Gene
-
Long gene nameBOC cell adhesion associated, oncogene regulated
-
Synonyms gene name
- Boc homolog (mouse)
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2006-02-02
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Ig-like cell adhesion molecule family
- I-set domain containing
- Fibronectin type III domain containing
-
VEGA ID