BMF cloning plasmid
-
Catalog numberCSB-CL850383HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the BMF gene.
-
SpecificationsGene name: BMF; Gene ID: 90427; Accession number: BC069505; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 555; Sequence: atggagccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagccggtgacccaacccgggagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccgacttcagctcttccctctcacccactgctgtggccctggccttcgacccaccagccaggaagacaaagctacccagactctcagcccagcctcccccagcccaggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctatcggcttcctctccctgccagtttcccagcagtcttgcccattggggagcagccccccgaagggcagtggcaacatcaagcagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccaaaatcgtgtgtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcaggccctaggtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolBMF, BMF-AS1
-
Short nameBMF cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameBcl2 modifying factor cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetBcl2 modifying factor, BMF and IDBG-6070 and ENSG00000104081 and 90427, protein binding, Plasma membranes, Bmf and IDBG-198160 and ENSMUSG00000040093 and 171543, BMF and IDBG-646206 and ENSBTAG00000012180 and 541141
-
Gene info
-
Identity
-
Gene
-
Long gene nameBcl2 modifying factor
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2004-01-16
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- BCL2 homology region 3 (BH3) only
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameBMF antisense RNA 1
-
Locus
-
Discovery year2017-07-06
-
Classification
- Antisense RNAs