BLOC1S2 cloning plasmid

• Catalog number
  CSB-CL754307HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the BLOC1S2 gene.
• Specifications
  Gene name: BLOC1S2; Gene ID: 282991; Accession number: BC020494; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 300; Sequence: atgttctccaaaatggccacttacctgactggggaactgacggccaccagtgaagactataagctcctggaaaatatgaataaactcaccagcttgaagtatcttgaaatgaaagatattgctataaacattagtaggaacttaaaggacttaaaccagaaatatgctggactgcagccttatctggatcagatcaatgtcattgaagagcaggtagcagctcttgagcaggcagcttacaagttggatgcatattcaaaaaaactggaagccaagtacaagaagctggagaagcgatga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  BLOC1S2   cloning  
• Gene symbol
  BLOC1S2
• Short name
  BLOC1S2 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  biogenesis on lysosomal organelles aggregate-1, functionnal sequence 2 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  biogenesis of lysosomal organelles complex-1, subunit 2, BLOC1S2 and IDBG-86384 and ENSG00000196072 and 282991, gamma-tubulin binding, nuclei, Bloc1s2a and IDBG-169426 and ENSMUSG00000057506 and 638532,73689, BLOC1S2 and IDBG-638723 and ENSBTAG00000010739 and 519172

Gene info

• Identity
  HGNC:20984
• Gene
  BLOC1S2
• Long gene name
  biogenesis of lysosomal organelles complex 1 subunit 2
• Synonyms
  • MGC10120
  • FLJ30135
  • BLOS2
  • BORCS2
• Synonyms name
  • centrosome protein oncogene
  • Biogenesis of Lysosome-related Organelles complex-1 Subunit 2
  • BLOC-1 subunit 2
• GenBank acession
  • AK054697
• Locus
  10q24.31
• Discovery year
  2004-05-24
• Entrez gene record
  282991
• Pubmed identfication
  • 11483580
  • 15102850
• RefSeq identity
  • NM_173809
• Classification
  • Biogenesis of lysosomal organelles complex 1 subunits
  • BLOC-1 related complex subunits
• VEGA ID
  OTTHUMG00000018908

Similar products