AVP cloning plasmid
-
Catalog numberCSB-CL002466HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the AVP gene.
-
SpecificationsGene name: AVP; Gene ID: 551; Accession number: BC126196; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 495; Sequence: atgcctgacaccatgctgcccgcctgcttcctcggcctactggccttctcctccgcgtgctacttccagaactgcccgaggggcggcaagagggccatgtccgacctggagctgagacagtgcctcccctgcggccccgggggcaaaggccgctgcttcgggcccagcatctgctgcgcggacgagctgggctgcttcgtgggcacggctgaggcgctgcgctgccaggaggagaactacctgccgtcgccctgccagtccggccagaaggcgtgcgggagcgggggccgctgcgccgccttcggcgtttgctgcaacgacgagagctgcgtgaccgagcccgagtgccgcgagggctttcaccgccgcgcccgcgccagcgaccggagcaacgccacgcagctggacgggccggccggggccttgctgctgcggctggtgcagctggccggggcgcccgagcccttcgagcccgcccagcccgacgcctactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolAVP, NLRP3
-
Short nameAVP cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namearginine vasopressin cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetarginine vasopressin, ADH and ARVP and AVP-NPII and AVRP and VP, AVP and IDBG-45432 and ENSG00000101200 and 551, cysteine-type endopeptidase inhibitor activity involved in apoptotic process, Extracellular, Avp and IDBG-206576 and ENSMUSG00000037727 and 11998, AVP and IDBG-640134 and ENSBTAG00000008027 and 280728
-
Gene info
-
Identity
-
Gene
-
Long gene namearginine vasopressin
-
Synonyms gene
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1986-01-01
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Neuropeptides
-
VEGA ID
-
Locus Specific Databases
Gene info
-
Identity
-
Gene
-
Long gene nameNLR family pyrin domain containing 3
-
Synonyms gene
-
Synonyms gene name
- cold autoinflammatory syndrome 1
- deafness, autosomal dominant 34
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2001-08-28
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Pyrin domain containing
- NLR family
-
VEGA ID
-
Locus Specific Databases