ATP5J2 cloning plasmid
-
Catalog numberCSB-CL002370HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the ATP5J2 gene.
-
SpecificationsGene name: ATP5J2; Gene ID: 9551; Accession number: BC003678; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 285; Sequence: atggcgtcagttggtgagtgtccggccccagtaccagtgaaggacaagaaacttctggaggtcaaacttctggagctgccaagctggatcttgatgcgggacttcagtcctagtggcattttcggagcgtttcaaagaggttactaccggtactacaacaagtacatcaatgtgaagaaggggagcatctcggggattaccatggtgctggcatgctacgtgctctttagctactccttttcctacaagcatctcaagcacgagcggctccgcaaataccactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolATP5MF, ATP5MF-PTCD1
-
Short nameATP5J2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameATP5J2 cloning plasmid
-
Alternative techniqueplasmids
-
Gene info
-
Identity
-
Gene
-
Long gene nameATP synthase membrane subunit f
-
Synonyms gene
-
Synonyms gene name
- ATP synthase, H+ transporting, mitochondrial F0 complex, subunit f, isoform 2
- ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2
- ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2
- ATP synthase, H+ transporting, mitochondrial Fo complex subunit F2
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1999-07-22
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Mitochondrial complex V: ATP synthase subunits
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameATP5MF-PTCD1 readthrough
-
Synonyms gene
-
Synonyms gene name
- ATP5J2-PTCD1 readthrough
-
Locus
-
Discovery year2011-02-21
-
Entrez gene record
-
RefSeq identity
-
VEGA ID