ARRB2 cloning plasmid

• Catalog number
  CSB-CL002135HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the ARRB2 gene.
• Specifications
  Gene name: ARRB2; Gene ID: 409; Accession number: BC007427; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1230; Sequence: atgggggagaaacccgggaccagggtcttcaagaagtcgagccctaactgcaagctcaccgtgtacttgggcaagcgggacttcgtagatcacctggacaaagtggaccctgtagatggcgtggtgcttgtggaccctgactacctgaaggaccgcaaagtgtttgtgaccctcacctgcgccttccgctatggccgtgaagacctggatgtgctgggcttgtccttccgcaaagacctgttcatcgccacctaccaggccttccccccggtgcccaacccaccccggccccccacccgcctgcaggaccggctgctgaggaagctgggccagcatgcccaccccttcttcttcaccataccccagaatcttccatgctccgtcacactgcagccaggcccagaggatacaggaaaggcctgcggcgtagactttgagattcgagccttctgtgctaaatcactagaagagaaaagccacaaaaggaactctgtgcggctggtgatccgaaaggtgcagttcgccccggagaaacccggcccccagccttcagccgaaaccacacgccacttcctcatgtctgaccggtccctgcacctcgaggcttccctggacaaggagctgtactaccatggggagcccctcaatgtaaatgtccacgtcaccaacaactccaccaagaccgtcaagaagatcaaagtctctgtgagacagtacgccgacatctgcctcttcagcaccgcccagtacaagtgtcctgtggctcaactcgaacaagatgaccaggtatctcccagctccacattctgtaaggtgtacaccataaccccactgctcagtgacaaccgggagaagcggggtctcgccctggatgggaaactcaagcacgaggacaccaacctggcttccagcaccatcgtgaaggagggtgccaacaaggaggtgctgggaatcctggtgtcctacagggtcaaggtgaagctggtggtgtctcgaggcggggatgtctctgtggagctgccttttgttcttatgcaccccaagccccacgaccacatccccctccccagaccccagtcagccgctccggagacagatgtccctgtggacaccaacctcattgaatttgataccaactatgccacagatgatgacattgtgtttgaggactttgcccggcttcggctgaaggggatgaaggatgacgactatgatgatcaactctgctag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  ARRB2   cloning  
• Gene symbol
  ARRB2
• Short name
  ARRB2 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  arrestin, b 2 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  arrestin, beta 2, ARB2 and ARR2 and BARR2, ARRB2 and IDBG-19263 and ENSG00000141480 and 409, 14-3-3 protein binding, nuclei, Arrb2 and IDBG-194248 and ENSMUSG00000060216 and 216869, ARRB2 and IDBG-634360 and ENSBTAG00000035587 and 100851153,281638

Gene info

• Identity
  HGNC:712
• Gene
  ARRB2
• Long gene name
  arrestin beta 2
• Synonyms gene
  • ARR2
• Synonyms gene name
  • arrestin, beta 2
• Synonyms
  • BARR2
  • DKFZp686L0365
• Synonyms name
  • arrestin 3
• Locus
  17p13.2
• Discovery year
  1994-01-10
• Entrez gene record
  409
• Pubmed identfication
  • 7695743
• RefSeq identity
  • NM_004313
• Classification
  • Classical arrestins
• VEGA ID
  OTTHUMG00000090759

Similar products