APOC2 cloning plasmid
-
Catalog numberCSB-CL001932HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the APOC2 gene.
-
SpecificationsGene name: APOC2; Gene ID: 344; Accession number: BC065270; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 219; Sequence: atgggcacacgactcctcccagctctgtttcttgtcctcctggtattgggatttgaggtccaggggacccaacagccccagcaagatgagatgcctagcccgaccttcctcacccaggtgaaggaatctctctccagttactgggagtcagcaaagacagccgcccagaacctgtacgagaagacatacctgcccgctgtagatgagaaactcaggtag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolAPOC2, APOC4-APOC2
-
Short nameAPOC2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameapolipoprotein C-II cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetapolipoprotein C-II, APO-CII and APOC-II, APOC2 and IDBG-306903 and ENSG00000234906 and 344, lipoprotein lipase activator activity, Extracellular, Apoc2 and IDBG-151996 and ENSMUSG00000002992 and 11813, APOC2 and IDBG-639315 and ENSBTAG00000020558 and 618039
-
Gene info
-
Identity
-
Gene
-
Long gene nameapolipoprotein C2
-
Synonyms gene name
- apolipoprotein C-II
-
GenBank acession
-
Locus
-
Discovery year2001-06-22
-
Entrez gene record
-
RefSeq identity
-
Classification
- Apolipoproteins
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameAPOC4-APOC2 readthrough (NMD candidate)
-
Synonyms gene name
- APOC4-APOC2 readthrough
-
Locus
-
Discovery year2013-05-14
-
Entrez gene record
-
RefSeq identity
-
VEGA ID