ANK1 cloning plasmid

• Catalog number
  CSB-CL001720HU2-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the ANK1 gene.
• Specifications
  Gene name: ANK1; Gene ID: 286; Accession number: BC007930; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 396; Sequence: atgtggactttcgtcacccagctgttggtcacgctggtgctgctgagcttcttcctggtcagctgtcagaacgtgatgcacattgtcagggggtccctgtgctttgtgctaaagcacatccaccaggagctggacaaggagctgggggagagcgagggcctcagtgacgacgaggagaccatctccaccagggtggtccggcggcgggtcttcctgaaggggaatgagtttcagaatattccaggggagcaggtgacagaggagcaattcacggatgagcagggcaacattgtcaccaagaagatcattcgcaaggtggttcgacagatagacttgtccagcgccgatgccgcccaggagcacgaggaggatcacacctcgacacccaacccctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  ANK1   cloning  
• Gene symbol
  ANK1
• Short name
  ANK1 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  ankyrin 1, erythrocytic cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  ankyrin 1, erythrocytic, ANK and SPH1 and SPH2, ANK1 and IDBG-19055 and ENSG00000029534 and 286, ATPase binding, nuclei, Ank1 and IDBG-141556 and ENSMUSG00000031543 and 11733, ANK1 and IDBG-629690 and ENSBTAG00000003275 and 353108

Gene info

• Identity
  HGNC:492
• Gene
  ANK1
• Long gene name
  ankyrin 1
• Synonyms gene
  • ANK
• Synonyms gene name
  • ankyrin 1, erythrocytic
• Synonyms
  • SPH1
• GenBank acession
  • M28880
• Locus
  8p11.21
• Discovery year
  1989-06-06
• Entrez gene record
  286
• Pubmed identfication
  • 1689849
• RefSeq identity
  • NM_020475
• Classification
  • Ankyrin repeat domain containing
  • MicroRNA protein coding host genes
• VEGA ID
  OTTHUMG00000150281

Similar products