ANK1 cloning plasmid
-
Catalog numberCSB-CL001720HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the ANK1 gene.
-
SpecificationsGene name: ANK1; Gene ID: 286; Accession number: BC007930; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 396; Sequence: atgtggactttcgtcacccagctgttggtcacgctggtgctgctgagcttcttcctggtcagctgtcagaacgtgatgcacattgtcagggggtccctgtgctttgtgctaaagcacatccaccaggagctggacaaggagctgggggagagcgagggcctcagtgacgacgaggagaccatctccaccagggtggtccggcggcgggtcttcctgaaggggaatgagtttcagaatattccaggggagcaggtgacagaggagcaattcacggatgagcagggcaacattgtcaccaagaagatcattcgcaaggtggttcgacagatagacttgtccagcgccgatgccgcccaggagcacgaggaggatcacacctcgacacccaacccctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolANK1
-
Short nameANK1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameankyrin 1, erythrocytic cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetankyrin 1, erythrocytic, ANK and SPH1 and SPH2, ANK1 and IDBG-19055 and ENSG00000029534 and 286, ATPase binding, nuclei, Ank1 and IDBG-141556 and ENSMUSG00000031543 and 11733, ANK1 and IDBG-629690 and ENSBTAG00000003275 and 353108
-
Gene info
-
Identity
-
Gene
-
Long gene nameankyrin 1
-
Synonyms gene
-
Synonyms gene name
- ankyrin 1, erythrocytic
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1989-06-06
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Ankyrin repeat domain containing
- MicroRNA protein coding host genes
-
VEGA ID