ACAT1 cloning plasmid
-
Catalog numberCSB-CL001134HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the ACAT1 gene.
-
SpecificationsGene name: ACAT1; Gene ID: 38; Accession number: BC010942; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 489; Sequence: atggctgtgctgccggcacttctgcgcagcggcgcccgcagccgcagccccctgctccggaggctggtgcaggaaataagatatgtggaacggagttatgtatcaaaacccactttgaaggaagtggtcatagtaagtgctacaagaacacccattggatcttttttaggcagcctttccttgctgccagccactaagcttggttccattgcaattcagggagccattgaaaaggcagggattccaaaagaagaagtgaaagaagcatacatgggtaatgttctacaaggaggtgaaggacaagctcctacaaggcaggcagtattgggtgcaggcttacctatttctactccatgtaccaccataaacaaagtttgtgcttcaggaatgaaagccatcatgatggcctctcaaagtcttatgtgtggacatcagatcaagcaagagacaggctccttagcaaaaatatgctgtcatgtcaggaggtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolACAT1, SOAT1
-
Short nameACAT1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameACAT1 cloning plasmid
-
Alternative techniqueplasmids
-
Gene info
-
Identity
-
Gene
-
Long gene nameacetyl-CoA acetyltransferase 1
-
Synonyms gene
-
Synonyms gene name
- acetyl-Coenzyme A acetyltransferase 1
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1991-08-12
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID
-
Locus Specific Databases
Gene info
-
Identity
-
Gene
-
Long gene namesterol O-acyltransferase 1
-
Synonyms gene
-
Synonyms gene name
- sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1998-11-04
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID