ABO cloning plasmid

• Catalog number
  CSB-CL001110HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the ABO gene.
• Specifications
  Gene name: ABO; Gene ID: 28; Accession number: BC069595; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1065; Sequence: atggccgaggtgttgcggacgctggccggaaaaccaaaatgccacgcacttcgacctatgatccttttcctaataatgcttgtcttggtcttgtttggttacggggtcctaagccccagaagtctaatgccaggaagcctggaacgggggttctgcatggctgttagggaacctgaccatctgcagcgcgtctcgttgccaaggatggtctacccccagccaaaggtgctgacaccgtgtaggaaggatgtcctcgtggtgaccccttggctggctcccattgtctgggagggcacgttcaacatcgacatcctcaacgagcagttcaggctccagaacaccaccattgggttaactgtgtttgccatcaagaaatacgtggctttcctgaagctgttcctggagacggcggagaagcacttcatggtgggccaccgtgtccactactatgtcttcaccgaccagccggccgcggtgccccgcgtgacgctggggaccggtcggcagctgtcagtgctggaggtgggcgcctacaagcgctggcaggacgtgtccatgcgccgcatggagatgatcagtgacttctgcgagcggcgcttcctcagcgaggtggattacctggtgtgcgtggacgtggacatggagttccgcgaccatgtgggcgtggagatcctgactccgctgttcggcaccctgcaccccagcttctacggaagcagccgggaggccttcacctacgagcgccggccccagtcccaggcctacatccccaaggacgagggcgatttctactacatgggggcgttcttcggggggtcggtgcaagaggtgcagcggctcaccagggcctgccaccaggccatgatggtcgaccaggccaacggcatcgaggccgtgtggcacgacgagagccacctgaacaagtacctactgcgccacaaacccaccaaggtgctctcccccgagtacttgtgggaccaacagctgctgggctggcccgccgtcctgaggaagctgaggttcactgcggtgcccaagaaccaccaggcggtccggaacccgtga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  ABO   cloning  
• Gene symbol
  ABO
• Short name
  ABO cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase) cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase), A3GALNT and A3GALT1 and GTB and NAGAT, ABO and IDBG-90910 and ENSG00000175164 and 28, transferase activity, Extracellular, Abo and IDBG-149923 and ENSMUSG00000015787 and 80908, BT.29579 and IDBG-640601 and ENSBTAG00000012525 and 515340

Gene info

• Identity
  HGNC:79
• Gene
  ABO
• Long gene name
  ABO, alpha 1-3-N-acetylgalactosaminyltransferase and alpha 1-3-galactosyltransferase
• Synonyms gene name
  • ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
• Synonyms
  • A3GALNT
  • A3GALT1
• GenBank acession
  • AF134415
• Locus
  9q34.2
• Discovery year
  1986-01-01
• Entrez gene record
  28
• Pubmed identfication
  • 184030
• RefSeq identity
  • NM_020469
• Classification
  • Glycosyltransferase family 6
  • Blood group antigens
• VEGA ID
  OTTHUMG00000020872
• Locus Specific Databases
  • Blood Group Antigen Mutation Database
  • LRG_792

Similar products