PPIE cloning plasmid
-
Catalog numberCSB-CL890944HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PPIE gene.
-
SpecificationsGene name: PPIE; Gene ID: 10450; Accession number: BC004898; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 906; Sequence: atggccaccaccaagcgcgtcttgtacgtgggtggactggcagaggaagtggacgacaaagttcttcatgctgcgttcattccttttggagacatcacagatattcagattcctctggattatgaaacagaaaagcaccgaggatttgcttttgttgaatttgagttggcagaggatgctgcagcagctatcgacaacatgaatgaatctgagctttttggacgtacaattcgtgtcaatttggccaaaccaatgagaattaaggaaggctcttccaggccagtttggtcagatgatgactggttgaagaagttttctgggaagacgcttgaagagaataaagaggaagaagggtcagagcctcccaaagcagagacccaggagggagagcccattgctaaaaaggcccgctcaaatcctcaggtgtacatggacatcaagattgggaacaagccggctggccgcatccagatgctcctgcgttctgatgtcgtgcccatgacagcagagaatttccgctgcctgtgcactcatgaaaagggctttggctttaagggaagcagcttccaccgcatcatcccccagttcatgtgccagggcggtgatttcacaaaccacaatggcactgggggcaagtccatctatgggaagaagttcgatgatgaaaactttatcctcaagcatacgggaccaggtctactatccatggccaactctggcccaaacaccaatggctctcagttcttcctgacatgtgacaagacagactggctggatggcaagcatgtggtgtttggagaggtcaccgaaggcctagatgtcttgcggcaaattgaggcccagggcagcaaggacgggaagccaaagcagaaggtgatcatcgccgactgtggggagtacgtgtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPPIE
-
Short namePPIE cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namepeptidylprolyl isomerase E (cyclophilin E) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetpeptidylprolyl isomerase E (cyclophilin E), CYP-33 and CYP33, PPIE and IDBG-96746 and ENSG00000084072 and 10450, poly(A) RNA binding, nuclei, Ppie and IDBG-184920 and ENSMUSG00000028651 and 56031, BT.21742 and IDBG-640866 and ENSBTAG00000047314 and 100296550,787681
-
Gene info
-
Identity
-
Gene
-
Long gene namepeptidylprolyl isomerase E
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1999-07-07
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Cyclophilin peptidylprolyl isomerases
- Spliceosomal C complex
- Spliceosomal B complex
- Spliceosomal Bact complex
- Spliceosomal P complex
- RNA binding motif containing
-
VEGA ID
-
Locus Specific Databases