NME3 cloning plasmid

• Catalog number
  CSB-CL614400HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the NME3 gene.
• Specifications
  Gene name: NME3; Gene ID: 4832; Accession number: BC000250; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 510; Sequence: atgatctgcctggtgctgaccatcttcgctaacctcttccccgcggcctgcaccggcgcacacgaacgcaccttcctggccgtgaagccggacggcgtgcagcggcggctggtgggcgagattgtgcggcgcttcgagaggaagggcttcaagttggtggcgctgaagctggtgcaggcctccgaggagctgctgcgtgagcactacgccgagctgcgtgaacgcccgttctacggccgccttgtcaagtatatggcctccgggccggtggtggccatggtttggcaggggctggacgtggtgcgcacctcgcgggcgctcatcggagccacgaacccggccgacgccccgcccggcaccatccgcggggatttctgcatcgaggttggcaagaacctgattcacggcagcgactcggtggagagtgcccgccgcgagatcgctctctggttccgcgcagacgagctcctctgctgggaggacagcgctgggcactggctgtatgagtag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  NME3   cloning  
• Gene symbol
  NME3
• Short name
  NME3 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  NME/NM23 nucleoside diphosphate kinase 3 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  NME/NM23 nucleoside diphosphate kinase 3, c371H6.2 and DR-nm23 and NDPK-C and NDPKC and NM23-H3 and NM23H3, NME3 and IDBG-9255 and ENSG00000103024 and 4832, metal ion binding, multiple, Nme3 and IDBG-149843 and ENSMUSG00000073435 and 79059, NME3 and IDBG-634801 and ENSBTAG00000016552 and 515663

Gene info

• Identity
  HGNC:7851
• Gene
  NME3
• Long gene name
  NME/NM23 nucleoside diphosphate kinase 3
• Synonyms gene name
  • non-metastatic cells 3, protein expressed in
• Synonyms
  • DR-nm23
  • NM23-H3
  • NDPKC
• GenBank acession
  • U29656
• Locus
  16p13.3
• Discovery year
  1996-12-19
• Entrez gene record
  4832
• Pubmed identfication
  • 9067290
  • 19852809
• RefSeq identity
  • NM_002513
• Classification
  • NME/NM23 family
• VEGA ID
  OTTHUMG00000128635

Similar products