SCARB2 cloning plasmid

• Catalog number
  CSB-CL619859HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the SCARB2 gene.
• Specifications
  Gene name: SCARB2; Gene ID: 950; Accession number: BC021892; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1437; Sequence: atgggccgatgctgcttctacacggcggggacgttgtccctgctcctgctggtgaccagcgtcacgctgctggtggcccgggtcttccagaaggctgtagaccagagtatcgagaagaaaattgtgttaaggaatggtactgaggcatttgactcctgggagaagccccctctgcctgtgtatactcagttctatttcttcaatgtcaccaatccagaggagatcctcagaggggagacccctcgggtggaagaagtggggccatacacctacagggaactcagaaacaaagcaaatattcaatttggagataatggaacaacaatatctgctgttagcaacaaggcctatgtttttgaacgagaccaatctgttggagaccctaaaattgacttaattagaacattaaatattcctgtattgactgtcatagagtggtcccaggtgcacttcctcagggagatcatcgaggccatgttgaaagcctatcagcagaagctctttgtgactcacacagttgacgaattgctctggggctacaaagatgaaatcttgtcccttatccatgttttcaggcccgatatctctccctattttggcctattctatgagaaaaatgggactaatgatggagactatgtttttctaactggagaagacagttaccttaactttacaaaaattgtggaatggaatgggaaaacgtcacttgactggtggataacagacaagtgcaatatgattaatggaacagatggagattcttttcacccactaataaccaaagatgaggtcctttatgtcttcccatctgacttttgcaggtcagtgtatattactttcagtgactatgagagtgtacagggactgcctgcctttcggtataaagttcctgcagaaatattagccaatacgtcagacaatgccggcttctgtatacctgagggaaactgcctgggctcaggagttctgaatgtcagcatctgcaagaatggtgcacccatcattatgtctttcccacacttttaccaagcagatgagaggtttgtttctgccatagaaggcatgcacccaaatcaggaagaccatgagacatttgtggacattaatcctttgactggaataatcctaaaagcagccaagaggttccaaatcaacatttatgtcaaaaaattagatgactttgttgaaacgggagacattagaaccatggttttcccagtgatgtacctcaatgagagtgttcacattgataaagagacggcgagtcgactgaagtctatgattaacactactttgatcatcaccaacataccctacatcatcatggcgctgggtgtgttctttggtttggtttttacctggcttgcatgcaaaggacagggatccatggatgagggaacagcggatgaaagagcacccctcattcgaacctaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  SCARB2   cloning  
• Gene symbol
  SCARB2
• Short name
  SCARB2 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  scavenger receptor class B, member 2 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  scavenger receptor class B, member 2, AMRF and CD36L2 and EPM4 and HLGP85 and LGP85 and LIMP-2 and LIMPII and SR-BII, SCARB2 and IDBG-25361 and ENSG00000138760 and 950, enzyme binding, Plasma membranes, Scarb2 and IDBG-180164 and ENSMUSG00000029426 and 12492, SCARB2 and IDBG-643116 and ENSBTAG00000010956 and 533177

Gene info

• Identity
  HGNC:1665
• Gene
  SCARB2
• Long gene name
  scavenger receptor class B member 2
• Synonyms gene
  • CD36L2
• Synonyms gene name
  • CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II)
• Synonyms
  • HLGP85
  • LIMPII
  • SR-BII
  • LIMP-2
• Synonyms name
  • lysosome membrane protein 2
  • lysosomal integral membrane protein II
• GenBank acession
  • D12676
• Locus
  4q21.1
• Discovery year
  1994-09-07
• Entrez gene record
  950
• Pubmed identfication
  • 1374238
• RefSeq identity
  • NM_005506
• Classification
  • Scavenger receptors
• VEGA ID
  OTTHUMG00000130099

Similar products