KIAA1984 cloning plasmid
-
Catalog numberCSB-CL719407HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the KIAA1984 gene.
-
SpecificationsGene name: KIAA1984; Gene ID: 84960; Accession number: BC007542; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 291; Sequence: atggtgtccaggaccgaggagggcgacacaaaggtgagggacaccctggagtcctcgactctgatggagaagtacaacaccaggatcagctttgagaaccgggaggaggatatgatcggactgctgcggacgctggggcgaccggggtctcggagaggagcacgggacacgcaggatcgggggaggttctgcgtaaggaggcagcccgggcccggaactgcgcgccagaaccgcgtgcgcatgcgccgaccgcgcgcgccgcgcccccgcggccctcgcggcgccccgtag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCCDC183, CCDC183-AS1
-
Short nameKIAA1984 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameKIAA1984 cloning plasmid
-
Alternative techniqueplasmids
-
Gene info
-
Identity
-
Gene
-
Long gene namecoiled-coil domain containing 183
-
Synonyms gene
-
Synonyms gene name
- KIAA1984
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2004-02-19
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameCCDC183 antisense RNA 1
-
Synonyms gene
-
Synonyms gene name
- KIAA1984 antisense RNA 1 (non-protein coding)
- KIAA1984 antisense RNA 1
-
GenBank acession
-
Locus
-
Discovery year2012-06-28
-
Entrez gene record
-
RefSeq identity
-
Classification
- Antisense RNAs
-
VEGA ID