AZGP1 cloning plasmid
-
Catalog numberCSB-CL002479HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the AZGP1 gene.
-
SpecificationsGene name: AZGP1; Gene ID: 563; Accession number: BC033830; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 897; Sequence: atggtaagaatggtgcctgtcctgctgtctctgctgctgcttctgggtcctgctgtcccccaggagaaccaagatggtcgttactctctgacctatatctacactgggctgtccaagcatgttgaagacgtccccgcgtttcaggcccttggctcactcaatgacctccagttctttagatacaacagtaaagacaggaagtctcagcccatgggactctggagacaggtggaaggaatggaggattggaagcaggacagccaacttcagaaggccagggaggacatctttatggagaccctgaaagacattgtggagtattacaacgacagtaacgggtctcacgtattgcagggaaggtttggttgtgagatcgagaataacagaagcagcggagcattctggaaatattactatgatggaaaggactacattgaattcaacaaagaaatcccagcctgggtccccttcgacccagcagcccagataaccaagcagaagtgggaggcagaaccagtctacgtgcagcgggccaaggcttacctggaggaggagtgccctgcgactctgcggaaatacctgaaatacagcaaaaatatcctggaccggcaagatcctccctctgtggtggtcaccagccaccaggccccaggagaaaagaagaaactgaagtgcctggcctacgacttctacccagggaaaattgatgtgcactggactcgggccggcgaggtgcaggagcctgagttacggggagatgttcttcacaatggaaatggcacttaccagtcctgggtggtggtggcagtgcccccgcaggacacagccccctactcctgccacgtgcagcacagcagcctggcccagcccctcgtggtgccctgggaggccagctag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolAZGP1
-
Short nameAZGP1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namealpha-2-glycoprotein 1, zinc-binding cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetalpha-2-glycoprotein 1, zinc-binding, ZA2G and ZAG, AZGP1 and IDBG-30185 and ENSG00000160862 and 563, peptide antigen binding, nuclei, Azgp1 and IDBG-205632 and ENSMUSG00000037053 and 12007, AZGP1 and IDBG-640744 and ENSBTAG00000026236 and 508800
-
Gene info
-
Identity
-
Gene
-
Long gene namealpha-2-glycoprotein 1, zinc-binding
-
Synonyms gene name
- alpha-2-glycoprotein 1, zinc
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1991-09-12
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- C1-set domain containing
-
VEGA ID