TNFAIP8 cloning plasmid
-
Catalog numberCSB-CL023960HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TNFAIP8 gene.
-
SpecificationsGene name: TNFAIP8; Gene ID: 25816; Accession number: BC005352; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 597; Sequence: atgcactccgaagcagaagaatccaaggaagtggccacagatgtctttaattccaaaaacctggccgttcaggcacaaaagaagatcttgggtaaaatggtgtccaaatccatcgccaccaccttaatagacgacacaagtagtgaggtgctggacgagctctacagagtgaccagggagtacacccaaaacaagaaggaggcagagaagatcatcaagaacctcatcaagacagtcatcaagctggccattctttataggaataatcagtttaatcaagatgagctagcattgatggagaaatttaagaagaaagttcatcagcttgctatgaccgtggtcagtttccatcaggtggattatacctttgaccggaatgtgttatccaggctgttaaatgaatgcagagagatgctgcaccaaatcattcagcgccacctcactgccaagtcacatggacgggttaataatgtctttgatcatttttcagattgtgaatttttggctgccttgtataatccttttgggaattttaaaccccacttacaaaaactatgtgatggtatcaacaaaatgttggatgaagagaacatatga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTNFAIP8
-
Short nameTNFAIP8 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nametumor necrosis factor, a-induced protein 8 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targettumor necrosis factor, alpha-induced protein 8, GG2-1 and MDC-3.13 and NDED and SCC-S2 and SCCS2, TNFAIP8 and IDBG-38402 and ENSG00000145779 and 25816, cysteine-type endopeptidase inhibitor activity involved in apoptotic process, Cytoplasm, Tnfaip8 and IDBG-146216 and ENSMUSG00000062210 and 106869, TNFAIP8 and IDBG-645003 and ENSBTAG00000014551 and 529336
-
Gene info
-
Identity
-
Gene
-
Long gene nameTNF alpha induced protein 8
-
Synonyms gene name
- tumor necrosis factor, alpha-induced protein 8
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2004-02-11
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID