GNAO1 cloning plasmid
-
Catalog numberCSB-CL009593HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the GNAO1 gene.
-
SpecificationsGene name: GNAO1; Gene ID: 2775; Accession number: BC030027; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 909; Sequence: atgaagatcatccatgaagatggcttctccggagaagacgtgaaacagtacaagcctgttgtctacagcaacactatccagtccctggcagccatcgtccgggccatggacactttgggcatcgaatatggtgataaggagagaaaggctgacgccaagatggtgtgtgatgtggtgagtcggatggaagacaccgagcccttctctgcagagctgctttctgccatgatgcggctctggggcgactcaggaatccaagagtgcttcaaccggtcccgggagtatcagctcaacgactctgccaaatactacctggacagcctggatcggattggggccgccgactaccagcccaccgagcaggacatcctccgaaccagggtcaaaaccactggcatcgtagaaacccacttcacattcaagaacctccacttcaggctgtttgacgtcggaggccagcgatctgaacgcaagaagtggatccattgcttcgaggacgtcacggccatcattttctgtgtcgcgctcagcggctatgaccaggtgctccacgaagacgaaaccacgaaccgcatgcacgagtctctcatgctcttcgactccatctgtaacaacaagttcttcatcgatacctccatcattctcttcctcaacaagaaagatctctttggcgagaagatcaagaagtcacctttgaccatctgctttcctgaatacacaggccccaatacctatgaagacgcagccgcctacatccaagcacaatttgaaagcaaaaaccgctcacccaacaaagaaatatattgtcacatgacttgtgccacagacacgaataacatccaggtggtgttcgacgccgtcaccgacatcatcattgccaacaacctccggggctgcggcttgtactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolGNAO1-DT, GNAO1-AS1, GNAO1
-
Short nameGNAO1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameguanine nucleotide binding protein (G protein), alpha activating activity polypeptide O cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetguanine nucleotide binding protein (G protein), alpha activating activity polypeptide O, EIEE17 and G-ALPHA-o and GNAO, GNAO1 and IDBG-31702 and ENSG00000087258 and 2775, corticotropin-releasing hormone receptor 1 binding, Plasma membranes, Gnao1 and IDBG-181138 and ENSMUSG00000031748 and 14681, GNAO1 and IDBG-632074 and ENSBTAG00000003794 and 281792
-
Gene info
-
Identity
-
Gene
-
Long gene nameGNAO1 divergent transcript
-
Locus
-
Discovery year2021-04-29
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Divergent transcripts
Gene info
-
Identity
-
Gene
-
Long gene nameGNAO1 antisense RNA 1
-
Locus
-
Discovery year2020-11-11
-
Entrez gene record
-
RefSeq identity
-
Classification
- Antisense RNAs
Gene info
-
Identity
-
Gene
-
Long gene nameG protein subunit alpha o1
-
Synonyms gene name
- guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
-
Synonyms
-
Locus
-
Discovery year1988-04-24
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- G protein subunits alpha, group i
- MicroRNA protein coding host genes
-
VEGA ID