GNAO1 cloning plasmid

  • Catalog number
    CSB-CL009593HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the GNAO1 gene.
  • Specifications
    Gene name: GNAO1; Gene ID: 2775; Accession number: BC030027; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 909; Sequence: atgaagatcatccatgaagatggcttctccggagaagacgtgaaacagtacaagcctgttgtctacagcaacactatccagtccctggcagccatcgtccgggccatggacactttgggcatcgaatatggtgataaggagagaaaggctgacgccaagatggtgtgtgatgtggtgagtcggatggaagacaccgagcccttctctgcagagctgctttctgccatgatgcggctctggggcgactcaggaatccaagagtgcttcaaccggtcccgggagtatcagctcaacgactctgccaaatactacctggacagcctggatcggattggggccgccgactaccagcccaccgagcaggacatcctccgaaccagggtcaaaaccactggcatcgtagaaacccacttcacattcaagaacctccacttcaggctgtttgacgtcggaggccagcgatctgaacgcaagaagtggatccattgcttcgaggacgtcacggccatcattttctgtgtcgcgctcagcggctatgaccaggtgctccacgaagacgaaaccacgaaccgcatgcacgagtctctcatgctcttcgactccatctgtaacaacaagttcttcatcgatacctccatcattctcttcctcaacaagaaagatctctttggcgagaagatcaagaagtcacctttgaccatctgctttcctgaatacacaggccccaatacctatgaagacgcagccgcctacatccaagcacaatttgaaagcaaaaaccgctcacccaacaaagaaatatattgtcacatgacttgtgccacagacacgaataacatccaggtggtgttcgacgccgtcaccgacatcatcattgccaacaacctccggggctgcggcttgtactga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    GNAO1   cloning  
  • Gene symbol
    GNAO1-DT, GNAO1-AS1, GNAO1
  • Short name
    GNAO1 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O, EIEE17 and G-ALPHA-o and GNAO, GNAO1 and IDBG-31702 and ENSG00000087258 and 2775, corticotropin-releasing hormone receptor 1 binding, Plasma membranes, Gnao1 and IDBG-181138 and ENSMUSG00000031748 and 14681, GNAO1 and IDBG-632074 and ENSBTAG00000003794 and 281792
Gene info
  • Identity
  • Gene
  • Long gene name
    GNAO1 divergent transcript
  • Locus
  • Discovery year
    2021-04-29
  • Entrez gene record
  • Pubmed identfication
  • RefSeq identity
  • Classification
    • Divergent transcripts
Gene info
  • Identity
  • Gene
  • Long gene name
    GNAO1 antisense RNA 1
  • Locus
  • Discovery year
    2020-11-11
  • Entrez gene record
  • RefSeq identity
  • Classification
    • Antisense RNAs
Gene info
  • Identity
  • Gene
  • Long gene name
    G protein subunit alpha o1
  • Synonyms gene name
    • guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
  • Synonyms
  • Locus
  • Discovery year
    1988-04-24
  • Entrez gene record
  • Pubmed identfication
  • RefSeq identity
  • Classification
    • G protein subunits alpha, group i
    • MicroRNA protein coding host genes
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee