FSCN2 cloning plasmid

• Catalog number
  CSB-CL009011HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the FSCN2 gene.
• Specifications
  Gene name: FSCN2; Gene ID: 25794; Accession number: BC130330; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1479; Sequence: atgccgacgaacggcctgcaccaggtgctgaagatccagtttggcctcgtcaacgacactgaccgctacctgacagctgagagcttcggcttcaaggtcaatgcctcggcacccagcctcaagaggaagcagacctgggtgctggaacccgacccaggacaaggcacggctgtgctgctccgcagcagccacctgggccgctacctgtcggcagaagaggacgggcgcgtggcctgtgaggcagagcagccgggccgtgactgccgcttcctggtcctgccgcagccagatgggcgctgggtgctgcggtccgagccgcacggccgcttcttcggaggcaccgaggaccagctgtcctgcttcgccacagccgtttccccggccgagctgtggaccgtgcacctggccatccacccgcaggcccacctgctgagcgtgagccggcggcgctacgtgcacctgtgcccgcgggaggacgagatggccgcagacggagacaagccctggggcgtggacgccctcctcaccctcatcttccggagccgacggtactgcctcaagtcctgtgacagccgctacctgcgcagcgacggccgtctggtctgggagcctgagccccgtgcctgctacacgctggagttcaaggcgggcaagctggccttcaaggactgcgacggccactacctggcacccgtggggcccgctggcaccctcaaggccggccgaaacacgcgacctggcaaggatgagctctttgatctggaggagagtcacccacaggtggtgctggtggctgccaaccaccgctacgtctctgtgcggcaaggggtcaacgtctcagccaatcaggatgatgaactagaccacgagaccttcctgatgcaaattgaccaggagacaaagaagtgcaccttctattccagcactgggggctactggaccctggtcacccatgggggcattcacgccacagccacacaagtttctgccaacaccatgtttgagatggagtggcgtggccggcgggtagcactcaaagccagcaacgggcgctacgtgtgcatgaagaagaatgggcagctggcggctatcagcgattttgtcggcaaggacgaagagttcaccctcaagctcatcaaccggcccatcctggtgctgcgcggcctggacggcttcgtctgccaccaccgcggctccaaccagctggacaccaaccgctccgtctacgacgtcttccacctgagcttcagcgacggcgcctaccggatccgaggccgcgacggagggttctggtacacgggcagccacggcagcgtgtgcagcgacggcgaacgcgccgaggacttcgtcttcgagttccgtgagcgcggccgcctggccatccgcgcccggagcggcaagtacctgcgcggcggcgcctcgggcctgctgcgggccgatgccgatgccccggccgggaccgcgctttgggagtactga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  FSCN2   cloning  
• Gene symbol
  FSCN2
• Short name
  FSCN2 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus) cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus), RFSN and RP30, FSCN2 and IDBG-72335 and ENSG00000186765 and 25794, protein binding, Cytoplasm, Fscn2 and IDBG-214785 and ENSMUSG00000025380 and 238021, FSCN2 and IDBG-642519 and ENSBTAG00000024932 and 337926

Gene info

• Identity
  HGNC:3960
• Gene
  FSCN2
• Long gene name
  fascin actin-bundling protein 2, retinal
• Synonyms gene name
  • fascin (Strongylocentrotus purpuratus) homolog 2 (actin-bundling protein, retinal)
  • fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)
• Synonyms
  • RP30
  • RFSN
• Synonyms name
  • retinal fascin
• GenBank acession
  • AF030165
• Locus
  17q25.3
• Discovery year
  2000-02-29
• Entrez gene record
  25794
• Pubmed identfication
  • 10234509
• RefSeq identity
  • NM_012418
• Classification
  • Fascin family
• VEGA ID
  OTTHUMG00000167477
• Locus Specific Databases
  • Mutations of the Fascin Gene

Similar products