DPCR1 cloning plasmid

• Catalog number
  CSB-CL660840HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the DPCR1 gene.
• Specifications
  Gene name: DPCR1; Gene ID: 135656; Accession number: BC069477; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 708; Sequence: atgacacaagtcacagaaaagtccacagaacacccagaaaagaccacgtcaaccacagagaaaaccacaagaaccccagaaaagcctacgctatactcagagaagaccatatgcaccaaagggaaaaacacaccagtcccagaaaagcctacagaaaacctggggaacaccacactgaccactgagaccataaaagccccagtaaagtccacagaaaacccagaaaaaacagcagcagtcacaaagactataaaaccttcagtcaaggtcacaggagacaaatctctcactactacctcttctcatctaaataaaactgaagttactcatcaggtgcccactggttctttcaccctcattacatctagaacgaagctgagttctatcacatcagaagccacaggaaacgagagccatccatacctcaataaagatggctcacagaaaggtatccacgctggacagatgggagagaatgattcattccctgcatgggccatagttattgtggtcctggtggctgtgattctcctcctggtgttccttggcctgatcttcttggtctcctatatgatgcggacacgccgcacactaacccagaacacccagtacaatgatgcagaggatgagggtggccccaattcctacccggtctacctgatggagcagcagaatcttggcatgggccagatcccttccccacggtga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  DPCR1   cloning  
• Gene symbol
  MUCL3
• Short name
  DPCR1 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  DPCR1 cloning plasmid
• Alternative technique
  plasmids

Gene info

• Identity
  HGNC:21666
• Gene
  MUCL3
• Long gene name
  mucin like 3
• Synonyms gene
  • DPCR1
• Synonyms gene name
  • diffuse panbronchiolitis critical region 1
• Synonyms
  • PBLT
  • bCX105N19.6
  • C6orf37
• GenBank acession
  • AB064272
• Locus
  6p21.33
• Discovery year
  2004-02-03
• Entrez gene record
  135656
• Pubmed identfication
  • 12185533
  • 10677310
• RefSeq identity
  • NM_080870
• VEGA ID
  OTTHUMG00000031104

MeSH Data

• Name
  Polymerase Chain Reaction
• Concept
  Scope note: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
• Tree numbers
  • E05.393.620.500
• Qualifiers
  ethics, trends, veterinary, history, classification, economics, instrumentation, methods, standards, statistics & numerical data

Similar products