-
Description
A cloning plasmid for the IL2 gene.
-
Specifications
Gene name: IL2; Gene ID: 3558; Accession number: BC066257; Vector: pENTR223.1
-
Additional_information
Formulation: 10 μg plasmid + 200μl Glycerol; Length: 462; Sequence: atgtacaggatgcaactcctgtcttgcattgcactaagtcttgcacttgtcacaaacagtgcacctacttcaagttctacaaagaaaacacagctacaactggagcatttactgctggatttacagatgattttgaatggaattaataattacaagaatcccaaactcaccaggatgctcacatttaagttttacatgcccaagaaggccacagaactgaaacatcttcagtgtctagaagaagaactcaaacctctggaggaagtgctaaatttagctcaaagcaaaaactttcacttaagacccagggacttaatcagcaatatcaacgtaatagttctggaactaaagggatctgaaacaacattcatgtgtgaatatgctgatgagacagcaaccattgtagaatttctgaacagatggattaccttttgtcaaagcatcatctcaacactgacttga
-
Storage_and_shipping
Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
Notes
For research use only.
-
Gene
Interleukin-2 (IL-2) is an interleukin, a type of cytokine signaling molecule in the immune system. It is a protein that regulates the activities of white blood cells (leukocytes, often lymphocytes) that are responsible for immunity. IL-2 is part of the body's natural response to microbial infection, and in discriminating between foreign ("non-self") and "self". IL-2 mediates its effects by binding to IL-2 receptors, which are expressed by lymphocytes. Rec. E. coli interleukin-2 for T cell culture or antibody production is supplied by GENTAUR. Free samples on request.
-
Kit
Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
