PLP1 cloning plasmid
-
Catalog numberCSB-CL018202HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PLP1 gene.
-
SpecificationsGene name: PLP1; Gene ID: 5354; Accession number: BC002665; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 729; Sequence: atgggcttgttagagtgctgtgcaagatgtctggtaggggccccctttgcttccctggtggccactggattgtgtttctttggggtggcactgttctgtggctgtggacatgaagccctcactggcacagaaaagctaattgagacctatttctccaaaaactaccaagactatgagtatctcatcaatgtgatccatgccttccagtatgtcatctatggaactgcctctttcttcttcctttatggggccctcctgctggctgagggcttctacaccaccggcgcagtcaggcagatctttggcgactacaagaccaccatctgcggcaagggcctgagcgcaacgtttgtgggcatcacctatgccctgaccgttgtgtggctcctggtgtttgcctgctctgctgtgcctgtgtacatttacttcaacacctggaccacctgccagtctattgccttccccagcaagacctctgccagtataggcagtctctgtgctgacgccagaatgtatggtgttctcccatggaatgctttccctggcaaggtttgtggctccaaccttctgtccatctgcaaaacagctgagttccaaatgaccttccacctgtttattgctgcatttgtgggggctgcagctacactggtttccctgctcaccttcatgattgctgccacttacaactttgccgtccttaaactcatgggccgaggcaccaagttctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPLP1
-
Short namePLP1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameproteolipid protein 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetproteolipid protein 1, GPM6C and HLD1 and MMPL and PLP and PLP/DM20 and PMD and SPG2, PLP1 and IDBG-80835 and ENSG00000123560 and 5354, structural constituent of myelin sheath, Plasma membranes, Plp1 and IDBG-173392 and ENSMUSG00000031425 and 18823, PLP1 and IDBG-633948 and ENSBTAG00000006977 and 281410
-
Gene info
-
Identity
-
Gene
-
Long gene nameproteolipid protein 1
-
Synonyms gene
-
Synonyms gene name
- spastic paraplegia 2, uncomplicated
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2001-06-22
-
Entrez gene record
-
VEGA ID
-
Locus Specific Databases