CSF2RA cloning plasmid

• Catalog number
  CSB-CL006046HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the CSF2RA gene.
• Specifications
  Gene name: CSF2RA; Gene ID: 1438; Accession number: BC071835; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1203; Sequence: atgcttctcctggtgacaagccttctgctctgtgagttaccacacccagcattcctcctgatcccagagaaatcggatctgcgaacagtggcaccagcctctagtctcaatgtgaggtttgactccaggacgatgaatttaagctgggactgccaagaaaacacaaccttcagcaagtgtttcttaactgacaagaagaacagagtcgtggaacccaggctcagtaacaacgaatgttcgtgcacatttcgtgaaatttgtctgcatgaaggagtcacatttgaggttcacgtgaatactagtcaaagaggatttcaacagaaactgctttatccaaattcaggaagggagggtaccgctgctcagaatttctcctgtttcatctacaatgcggatttaatgaactgtacctgggcgaggggtccgacggccccccgtgacgtccagtattttttgtacatacgaaactcaaagagaaggagggagatccggtgtccttattacatacaagactcaggaacccatgtgggatgtcacctggataacctgtcaggattaacatctcgcaattactttctggttaacggaaccagccgagaaattggcatccaattctttgattcacttttggacacaaagaaaatagaacgattcaaccctcccagcaatgtcaccgtacgttgcaacacgacgcactgcctcgtacggtggaaacagcccaggacctatcagaagctgtcgtacctggactttcagtaccagctggacgtccacagaaagaatacccagcctggcacggaaaacctactgattaatgtttctggtgatttggaaaatagatacaactttccaagctctgagcccagagcaaaacacagtgtgaagatcagagctgcagacgtccgcatcttgaattggagctcctggagtgaagccattgaatttggttctgacgacgggaacctcggctctgtgtacatttatgtgctcctaatcgtaggaacccttgtctgtggcatcgtcctcggcttcctctttaaaaggttccttaggatacagcggctgttcccaccagttccacagatcaaagacaaactgaatgataaccatgaggtggaagacgagatcatctgggaggaattcaccccagaggaagggaaaggctaccgcgaagaggtcttgaccgtgaaggaaattacctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  CSF2RA   cloning  
• Gene symbol
  CSF2RA
• Short name
  CSF2RA cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  colony stimulating factor 2 receptor, a, low-affinity (granulocyte-macrophage) cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage), CD116 and CDw116 and CSF2R and CSF2RAX and CSF2RAY and CSF2RX and CSF2RY and GM-CSF-R-alpha and GMCSFR and GMR and SMDP4, CSF2RA and IDBG-39400 and ENSG00000198223 and 102725415,1438, protein binding, Extracellular, Csf2ra and IDBG-182098 and ENSMUSG00000059326 and 12982, CSF2RA and IDBG-642291 and ENSBTAG00000045948 and 100336606,511847

Gene info

• Identity
  HGNC:2435
• Gene
  CSF2RA
• Long gene name
  colony stimulating factor 2 receptor subunit alpha
• Synonyms gene
  • CSF2R
• Synonyms gene name
  • colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
• Synonyms
  • CD116
  • alphaGMR
• Synonyms name
  • alpha-GM-CSF receptor
• GenBank acession
  • M64445
• Locus
  Xp22.32 and Yp11.3
• Discovery year
  1990-07-03
• Entrez gene record
  1438
• Pubmed identfication
  • 1702217
• Classification
  • CD molecules
  • Pseudoautosomal region 1
• VEGA ID
  OTTHUMG00000012533
• Locus Specific Databases
  • Global Variome shared LOVD
  • LRG_186

Similar products