IL20RB cloning plasmid
-
Catalog numberCSB-CL740921HU3-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the IL20RB gene.
-
SpecificationsGene name: IL20RB; Gene ID: 53833; Accession number: BC063696; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 936; Sequence: atgcagactttcacaatggttctagaagaaatctggacaagtcttttcatgtggtttttctacgcattgattccatgtttgctcacagatgaagtggccattctgcctgcccctcagaacctctctgtactctcaaccaacatgaagcatctcttgatgtggagcccagtgatcgcgcctggagaaacagtgtactattctgtcgaataccagggggagtacgagagcctgtacacgagccacatctggatccccagcagctggtgctcactcactgaaggtcctgagtgtgatgtcactgatgacatcacggccactgtgccatacaaccttcgtgtcagggccacattgggctcacagacctcagcctggagcatcctgaagcatccctttaatagaaactcaaccatccttacccgacctgggatggagatcaccaaagatggcttccacctggttattgagctggaggacctggggccccagtttgagttccttgtggcctactggaggagggagcctggtgccgaggaacatgtcaaaatggtgaggagtgggggtattccagtgcacctagaaaccatggagccaggggctgcatactgtgtgaaggcccagacattcgtgaaggccattgggaggtacagcgccttcagccagacagaatgtgtggaggtgcaaggagaggccattcccctggtactggccctgtttgcctttgttggcttcatgctgatccttgtggtcgtgccactgttcgtctggaaaatgggccggctgctccagtactcctgttgccccgtggtggtcctcccagacaccttgaaaataaccaattcaccccagaagttaatcagctgcagaagggaggaggtggatgcctgtgccacggctgtgatgtctcctgaggaactcctcagggcctggatctcatag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolIL20RB-AS1, IL20RB
-
Short nameIL20RB cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameinterleukin 20 receptor b cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetinterleukin 20 receptor beta, IL20RB and IDBG-58036 and ENSG00000174564 and 53833, interleukin-20 binding, Plasma membranes, Il20rb and IDBG-193159 and ENSMUSG00000044244 and 213208, IL20RB and IDBG-638656 and ENSBTAG00000008299 and 534581
-
Gene info
-
Identity
-
Gene
-
Long gene nameIL20RB antisense RNA 1
-
Synonyms gene name
- IL20RB antisense RNA 1 (non-protein coding)
-
Locus
-
Discovery year2011-07-28
-
Classification
- Antisense RNAs
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameinterleukin 20 receptor subunit beta
-
Synonyms gene
-
Synonyms gene name
- fibronectin type III domain containing 6
- interleukin 20 receptor beta
- interleukin 20 receptor beta subunit
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2000-05-23
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Interleukin receptors
- Fibronectin type III domain containing
-
VEGA ID