CASP3 cloning plasmid
-
Catalog numberCSB-CL004548HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CASP3 gene.
-
SpecificationsGene name: CASP3; Gene ID: 836; Accession number: BC016926; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 834; Sequence: atggagaacactgaaaactcagtggattcaaaatccattaaaaatttggaaccaaagatcatacatggaagcgaatcaatggactctggaatatccctggacaacagttataaaatggattatcctgagatgggtttatgtataataattaataataagaattttcataaaagcactggaatgacatctcggtctggtacagatgtcgatgcagcaaacctcagggaaacattcagaaacttgaaatatgaagtcaggaataaaaatgatcttacacgtgaagaaattgtggaattgatgcgtgatgtttctaaagaagatcacagcaaaaggagcagttttgtttgtgtgcttctgagccatggtgaagaaggaataatttttggaacaaatggacctgttgacctgaaaaaaataacaaactttttcagaggggatcgttgtagaagtctaactggaaaacccaaacttttcattattcaggcctgccgtggtacagaactggactgtggcattgagacagacagtggtgttgatgatgacatggcgtgtcataaaataccagtggaggccgacttcttgtatgcatactccacagcacctggttattattcttggcgaaattcaaaggatggctcctggttcatccagtcgctttgtgccatgctgaaacagtatgccgacaagcttgaatttatgcacattcttacccgggttaaccgaaaggtggcaacagaatttgagtccttttcctttgacgctacttttcatgcaaagaaacagattccatgtattgtttccatgctcacaaaagaactctatttttatcactaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCASP3
-
Short nameCASP3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namecaspase 3, apoptosis-related cysteine peptidase cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetcaspase 3, apoptosis-related cysteine peptidase, CPP32 and CPP32B and SCA-1, CASP3 and IDBG-46394 and ENSG00000164305 and 836, cysteine-type endopeptidase activity involved in execution phase of apoptosis, nuclei, Casp3 and IDBG-154306 and ENSMUSG00000031628 and 12367, CASP3 and IDBG-628521 and ENSBTAG00000015874 and 408016
-
Gene info
-
Identity
-
Gene
-
Long gene namecaspase 3
-
Synonyms gene name
- caspase 3, apoptosis-related cysteine protease
- caspase 3, apoptosis-related cysteine peptidase
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1996-07-22
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Caspases
- Small nucleolar RNA protein coding host genes
-
VEGA ID
MeSH Data
-
Name
-
ConceptScope note: Theoretical representations that simulate the behavior or activity of chemical processes or phenomena; includes the use of mathematical equations, computers, and other electronic equipment.
-
Tree numbers
- E05.599.495