CASP3 cloning plasmid

  • Catalog number
    CSB-CL004548HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the CASP3 gene.
  • Specifications
    Gene name: CASP3; Gene ID: 836; Accession number: BC016926; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 834; Sequence: atggagaacactgaaaactcagtggattcaaaatccattaaaaatttggaaccaaagatcatacatggaagcgaatcaatggactctggaatatccctggacaacagttataaaatggattatcctgagatgggtttatgtataataattaataataagaattttcataaaagcactggaatgacatctcggtctggtacagatgtcgatgcagcaaacctcagggaaacattcagaaacttgaaatatgaagtcaggaataaaaatgatcttacacgtgaagaaattgtggaattgatgcgtgatgtttctaaagaagatcacagcaaaaggagcagttttgtttgtgtgcttctgagccatggtgaagaaggaataatttttggaacaaatggacctgttgacctgaaaaaaataacaaactttttcagaggggatcgttgtagaagtctaactggaaaacccaaacttttcattattcaggcctgccgtggtacagaactggactgtggcattgagacagacagtggtgttgatgatgacatggcgtgtcataaaataccagtggaggccgacttcttgtatgcatactccacagcacctggttattattcttggcgaaattcaaaggatggctcctggttcatccagtcgctttgtgccatgctgaaacagtatgccgacaagcttgaatttatgcacattcttacccgggttaaccgaaaggtggcaacagaatttgagtccttttcctttgacgctacttttcatgcaaagaaacagattccatgtattgtttccatgctcacaaaagaactctatttttatcactaa
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    CASP3   cloning  
  • Gene symbol
    CASP3
  • Short name
    CASP3 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    caspase 3, apoptosis-related cysteine peptidase cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    caspase 3, apoptosis-related cysteine peptidase, CPP32 and CPP32B and SCA-1, CASP3 and IDBG-46394 and ENSG00000164305 and 836, cysteine-type endopeptidase activity involved in execution phase of apoptosis, nuclei, Casp3 and IDBG-154306 and ENSMUSG00000031628 and 12367, CASP3 and IDBG-628521 and ENSBTAG00000015874 and 408016
Gene info
  • Identity
  • Gene
  • Long gene name
    caspase 3
  • Synonyms gene name
    • caspase 3, apoptosis-related cysteine protease
    • caspase 3, apoptosis-related cysteine peptidase
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    1996-07-22
  • Entrez gene record
    836
  • Pubmed identfication
  • RefSeq identity
  • Classification
    • Caspases
    • Small nucleolar RNA protein coding host genes
  • VEGA ID
MeSH Data
  • Name
  • Concept
    Scope note: Theoretical representations that simulate the behavior or activity of chemical processes or phenomena; includes the use of mathematical equations, computers, and other electronic equipment.
  • Tree numbers
    • E05.599.495
Similar products
Filters
Contact
Chat with gentaur.com employee